![]() |
|||||||
|
Fusion Protein:PLA2G2A-MBTPS1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: PLA2G2A-MBTPS1 | FusionPDB ID: 65858 | FusionGDB2.0 ID: 65858 | Hgene | Tgene | Gene symbol | PLA2G2A | MBTPS1 | Gene ID | 5320 | 8720 |
Gene name | phospholipase A2 group IIA | membrane bound transcription factor peptidase, site 1 | |
Synonyms | MOM1|PLA2|PLA2B|PLA2L|PLA2S|PLAS1|sPLA2 | PCSK8|S1P|SEDKF|SKI-1 | |
Cytomap | 1p36.13 | 16q23.3-q24.1 | |
Type of gene | protein-coding | protein-coding | |
Description | phospholipase A2, membrane associatedGIIC sPLA2NPS-PLA2group IIA phospholipase A2non-pancreatic secretory phospholipase A2phosphatidylcholine 2-acylhydrolase 2Aphospholipase A2, group IIA (platelets, synovial fluid) | membrane-bound transcription factor site-1 proteaseendopeptidase S1Pproprotein convertase subtilisin/kexin type 8site-1 proteasesubtilisin/kexin isozyme-1 | |
Modification date | 20200322 | 20200313 | |
UniProtAcc | . | Q14703 Main function of 5'-partner protein: FUNCTION: Serine protease that cleaves after hydrophobic or small residues, provided that Arg or Lys is in position P4: known substrates are SREBF1/SREBP1, SREBF2/SREBP2, BDNF, GNPTAB, ATF6 and ATF6B (PubMed:10644685, PubMed:12782636, PubMed:21719679). Cleaves substrates after Arg-Ser-Val-Leu (SREBP2), Arg-His-Leu-Leu (ATF6), Arg-Gly-Leu-Thr (BDNF) and its own propeptide after Arg-Arg-Leu-Leu (PubMed:10644685, PubMed:21719679). Catalyzes the first step in the proteolytic activation of the sterol regulatory element-binding proteins (SREBPs) SREBF1/SREBP1 and SREBF2/SREBP2 (PubMed:12782636). Also mediates the first step in the proteolytic activation of the cyclic AMP-dependent transcription factor ATF-6 (ATF6 and ATF6B) (PubMed:12782636). Mediates the protein cleavage of GNPTAB into subunit alpha and beta, thereby participating in biogenesis of lysosomes (PubMed:21719679). Involved in the regulation of M6P-dependent Golgi-to-lysosome trafficking of lysosomal enzymes (PubMed:21719679, PubMed:30046013). It is required for the activation of CREB3L2/BBF2H7, a transcriptional activator of MIA3/TANGO and other genes controlling mega vesicle formation (PubMed:30046013). Therefore, it plays a key role in the regulation of mega vesicle-mediated collagen trafficking (PubMed:30046013). {ECO:0000269|PubMed:10644685, ECO:0000269|PubMed:12782636, ECO:0000269|PubMed:21719679, ECO:0000269|PubMed:30046013}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000375111, ENST00000496748, ENST00000400520, | ENST00000569770, ENST00000343411, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 3 X 2=42 | 3 X 3 X 2=18 |
# samples | 7 | 3 | |
** MAII score | log2(7/42*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: PLA2G2A [Title/Abstract] AND MBTPS1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: PLA2G2A [Title/Abstract] AND MBTPS1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PLA2G2A(20301931)-MBTPS1(84103643), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. PLA2G2A-MBTPS1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | PLA2G2A | GO:0006644 | phospholipid metabolic process | 17069818 |
Hgene | PLA2G2A | GO:0046473 | phosphatidic acid metabolic process | 9032461 |
Hgene | PLA2G2A | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 22837859 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:20301931/chr16:84103643) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000496748 | PLA2G2A | chr1 | 20301931 | - | ENST00000343411 | MBTPS1 | chr16 | 84103643 | - | 3366 | 1306 | 1264 | 2682 | 472 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000496748 | ENST00000343411 | PLA2G2A | chr1 | 20301931 | - | MBTPS1 | chr16 | 84103643 | - | 0.003963079 | 0.99603695 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PLA2G2A-MBTPS1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
PLA2G2A | chr1 | 20301931 | MBTPS1 | chr16 | 84103643 | 1306 | 14 | YSGGSLLNKAISKSKNGAEQTSTVKL |
Top |
Potential FusionNeoAntigen Information of PLA2G2A-MBTPS1 in HLA I |
![]() |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Potential FusionNeoAntigen Information of PLA2G2A-MBTPS1 in HLA II |
![]() |
PLA2G2A-MBTPS1_20301931_84103643.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
PLA2G2A-MBTPS1 | chr1 | 20301931 | chr16 | 84103643 | 1306 | DRB1-0804 | GGSLLNKAISKSKNG | 2 | 17 |
PLA2G2A-MBTPS1 | chr1 | 20301931 | chr16 | 84103643 | 1306 | DRB1-1415 | GGSLLNKAISKSKNG | 2 | 17 |
Top |
Fusion breakpoint peptide structures of PLA2G2A-MBTPS1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PLA2G2A-MBTPS1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
Top |
Vaccine Design for the FusionNeoAntigens of PLA2G2A-MBTPS1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
PLA2G2A-MBTPS1 | chr1 | 20301931 | chr16 | 84103643 | 2 | 17 | GGSLLNKAISKSKNG | GGGGGGTCTCTTCTGAATAAAGCAATTAGCAAATCAAAAAATGGT |
Top |
Information of the samples that have these potential fusion neoantigens of PLA2G2A-MBTPS1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Top |
Potential target of CAR-T therapy development for PLA2G2A-MBTPS1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | MBTPS1 | chr1:20301931 | chr16:84103643 | ENST00000343411 | 12 | 23 | 999_1021 | 0 | 1053.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
PLA2G2A | chr1 | 20301931 | ENST00000496748 | MBTPS1 | chr16 | 84103643 | ENST00000343411 | ![]() |
Top |
Related Drugs to PLA2G2A-MBTPS1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PLA2G2A-MBTPS1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |