Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PLEKHM2-ECE1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PLEKHM2-ECE1
	FusionPDB ID: 66317
	FusionGDB2.0 ID: 66317
		Hgene	Tgene
	Gene symbol	PLEKHM2	ECE1
	Gene ID	23207	1889
	Gene name	pleckstrin homology and RUN domain containing M2	endothelin converting enzyme 1
	Synonyms	SKIP	ECE
	Cytomap	1p36.21	1p36.12
	Type of gene	protein-coding	protein-coding
	Description	pleckstrin homology domain-containing family M member 2PH domain-containing family M member 2SifA (Salmonella-induced filaments A) and kinesin-interacting proteinnovel RUN and PH domain-containing proteinpleckstrin homology domain containing, family M	endothelin-converting enzyme 1ECE-1
	Modification date	20200313	20200313
	UniProtAcc	.	P42892 Main function of 5'-partner protein: FUNCTION: Converts big endothelin-1 to endothelin-1. {ECO:0000269\|PubMed:9396733}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000375793, ENST00000375799, ENST00000477849,	ENST00000528294, ENST00000264205, ENST00000357071, ENST00000374893, ENST00000415912, ENST00000436918,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 7 X 6=378	10 X 12 X 6=720
	# samples	9	14
	** MAII score	log2(9/378*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/720*10)=-2.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PLEKHM2 [Title/Abstract] AND ECE1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PLEKHM2 [Title/Abstract] AND ECE1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PLEKHM2(16045120)-ECE1(21573856), # samples:1
Anticipated loss of major functional domain due to fusion event.	PLEKHM2-ECE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PLEKHM2-ECE1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PLEKHM2-ECE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PLEKHM2-ECE1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PLEKHM2	GO:1903527	positive regulation of membrane tubulation	18996344
Tgene	ECE1	GO:0010814	substance P catabolic process	18039931
Tgene	ECE1	GO:0010815	bradykinin catabolic process	18039931
Tgene	ECE1	GO:0010816	calcitonin catabolic process	18039931
Tgene	ECE1	GO:0016485	protein processing	7805846
Tgene	ECE1	GO:0016486	peptide hormone processing	7864876
Tgene	ECE1	GO:0034959	endothelin maturation	7805846
Tgene	ECE1	GO:0042447	hormone catabolic process	7864876

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:16045120/chr1:21573856)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PLEKHM2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ECE1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000375799	PLEKHM2	chr1	16045120	+	ENST00000415912	ECE1	chr1	21573856	-	4693	692	137	1984	615
ENST00000375799	PLEKHM2	chr1	16045120	+	ENST00000357071	ECE1	chr1	21573856	-	3356	692	137	1984	615
ENST00000375799	PLEKHM2	chr1	16045120	+	ENST00000374893	ECE1	chr1	21573856	-	2081	692	137	1984	615
ENST00000375799	PLEKHM2	chr1	16045120	+	ENST00000436918	ECE1	chr1	21573856	-	1950	692	137	1888	583
ENST00000375799	PLEKHM2	chr1	16045120	+	ENST00000264205	ECE1	chr1	21573856	-	2003	692	137	1984	615
ENST00000375793	PLEKHM2	chr1	16045120	+	ENST00000415912	ECE1	chr1	21573856	-	4635	634	79	1926	615
ENST00000375793	PLEKHM2	chr1	16045120	+	ENST00000357071	ECE1	chr1	21573856	-	3298	634	79	1926	615
ENST00000375793	PLEKHM2	chr1	16045120	+	ENST00000374893	ECE1	chr1	21573856	-	2023	634	79	1926	615
ENST00000375793	PLEKHM2	chr1	16045120	+	ENST00000436918	ECE1	chr1	21573856	-	1892	634	79	1830	583
ENST00000375793	PLEKHM2	chr1	16045120	+	ENST00000264205	ECE1	chr1	21573856	-	1945	634	79	1926	615

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000375799	ENST00000415912	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.009091333	0.9909087
ENST00000375799	ENST00000357071	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.008980526	0.9910194
ENST00000375799	ENST00000374893	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.014117137	0.9858828
ENST00000375799	ENST00000436918	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.011280903	0.98871905
ENST00000375799	ENST00000264205	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.013262627	0.98673743
ENST00000375793	ENST00000415912	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.009233803	0.99076617
ENST00000375793	ENST00000357071	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.009217711	0.9907823
ENST00000375793	ENST00000374893	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.013514166	0.98648584
ENST00000375793	ENST00000436918	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.01075103	0.989249
ENST00000375793	ENST00000264205	PLEKHM2	chr1	16045120	+	ECE1	chr1	21573856	-	0.012642313	0.98735774

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PLEKHM2-ECE1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PLEKHM2	chr1	16045120	ECE1	chr1	21573856	634	185	VSGLEFIRFELDLTLAPAINWLPFLN
PLEKHM2	chr1	16045120	ECE1	chr1	21573856	692	185	VSGLEFIRFELDLTLAPAINWLPFLN

Top

Potential FusionNeoAntigen Information of PLEKHM2-ECE1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PLEKHM2-ECE1_16045120_21573856.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:01	FELDLTLA	0.9712	0.8577	8	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:05	IRFELDLTL	0.9997	0.9196	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:04	IRFELDLTL	0.9997	0.7767	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:02	IRFELDLTL	0.9997	0.6645	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B58:01	LTLAPAINW	0.9992	0.9812	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:01	LTLAPAINW	0.9992	0.9907	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B58:02	LTLAPAINW	0.9979	0.9726	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:24	IRFELDLTL	0.9971	0.7934	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B14:01	IRFELDLTL	0.997	0.8898	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B14:02	IRFELDLTL	0.997	0.8898	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:01	IRFELDLTL	0.9965	0.9793	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:06	IRFELDLTL	0.996	0.8414	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:17	LTLAPAINW	0.9957	0.9661	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:02	IRFELDLTL	0.995	0.992	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:13	IRFELDLTL	0.9943	0.9869	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:01	IRFELDLTL	0.9941	0.9912	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B45:01	FELDLTLAP	0.9875	0.9914	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:03	LTLAPAINW	0.9727	0.9952	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:02	FELDLTLAP	0.9699	0.8337	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:16	LTLAPAINW	0.9607	0.9338	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-A32:13	LTLAPAINW	0.9311	0.9956	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:10	IRFELDLTL	0.9184	0.676	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:37	IRFELDLTL	0.9074	0.6984	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B53:01	LTLAPAINW	0.792	0.7857	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:18	IRFELDLTL	0.6163	0.7741	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:01	FELDLTLAP	0.5292	0.9612	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B41:01	FELDLTLAP	0.4923	0.9959	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B52:01	IRFELDLTL	0.0614	0.858	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:02	FELDLTLAPA	0.9884	0.8603	8	18
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:05	FIRFELDLTL	0.9842	0.9052	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:02	FIRFELDLTL	0.9834	0.5808	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:04	FIRFELDLTL	0.9823	0.7142	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:01	FELDLTLAPA	0.9372	0.9881	8	18
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:02	RFELDLTLAP	0.8637	0.8418	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B45:01	RFELDLTLAP	0.8321	0.9776	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:01	RFELDLTLAP	0.8205	0.9123	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B41:01	RFELDLTLAP	0.7865	0.9895	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:06	FIRFELDLTL	0.7298	0.7019	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:01	FIRFELDLTL	0.6309	0.8913	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:37	FIRFELDLTL	0.6022	0.6073	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:01	FIRFELDLTL	0.4692	0.9212	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:02	FIRFELDLTL	0.4572	0.9322	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:01	LDLTLAPAINW	0.9997	0.9942	10	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B58:01	LDLTLAPAINW	0.9967	0.9892	10	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:03	LDLTLAPAINW	0.9948	0.9971	10	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:01	EFIRFELDLTL	0.8062	0.7461	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:01	EFIRFELDLTL	0.5969	0.7933	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:02	EFIRFELDLTL	0.5918	0.8215	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B40:06	FELDLTLA	0.9997	0.7419	8	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C04:10	RFELDLTL	0.9996	0.9598	7	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:14	IRFELDLTL	0.9997	0.8378	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:05	IRFELDLTL	0.9979	0.984	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:95	IRFELDLTL	0.9977	0.8931	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:09	IRFELDLTL	0.9969	0.8882	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:27	IRFELDLTL	0.9969	0.975	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:12	IRFELDLTL	0.9963	0.981	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B40:06	FELDLTLAP	0.9951	0.8045	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:29	IRFELDLTL	0.9949	0.9667	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:13	IRFELDLTL	0.9943	0.9475	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:05	IRFELDLTL	0.9939	0.9747	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:03	IRFELDLTL	0.9853	0.9341	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B73:01	IRFELDLTL	0.9774	0.7935	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:67	IRFELDLTL	0.948	0.9629	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:80	IRFELDLTL	0.948	0.9629	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:46	IRFELDLTL	0.9433	0.9281	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:19	IRFELDLTL	0.9364	0.8403	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:10	IRFELDLTL	0.9258	0.9805	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B14:03	IRFELDLTL	0.5903	0.9304	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C12:16	IRFELDLTL	0.1558	0.9763	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:14	IRFELDLTLA	0.9993	0.6263	6	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B40:06	FELDLTLAPA	0.998	0.8041	8	18
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C12:16	FIRFELDLTL	0.9975	0.9688	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B73:01	IRFELDLTLA	0.9967	0.6747	6	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:14	FIRFELDLTL	0.9841	0.8285	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B40:06	RFELDLTLAP	0.9532	0.8267	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:05	FIRFELDLTL	0.9008	0.9672	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:29	FIRFELDLTL	0.8925	0.909	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:13	FIRFELDLTL	0.8903	0.9107	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:27	FIRFELDLTL	0.8633	0.946	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:95	FIRFELDLTL	0.8346	0.6693	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:46	FIRFELDLTL	0.8253	0.821	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B73:01	FIRFELDLTL	0.7626	0.6034	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:09	FIRFELDLTL	0.6808	0.5883	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:03	FIRFELDLTL	0.6662	0.9209	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:12	FIRFELDLTL	0.593	0.894	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:05	FIRFELDLTL	0.4534	0.8718	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B73:01	IRFELDLTLAP	0.9995	0.8499	6	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:12	EFIRFELDLTL	0.7661	0.7536	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:04	FELDLTLA	0.9712	0.8577	8	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:05	FELDLTLA	0.9712	0.8577	8	16
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:06	IRFELDLTL	0.9997	0.7673	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:08	IRFELDLTL	0.9997	0.8315	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:10	IRFELDLTL	0.9997	0.9036	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:09	IRFELDLTL	0.9995	0.9091	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:10	LTLAPAINW	0.9992	0.9907	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:04	LTLAPAINW	0.9984	0.9236	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:01	IRFELDLTL	0.9979	0.8405	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:31	IRFELDLTL	0.9969	0.9797	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:02	IRFELDLTL	0.9964	0.987	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B58:06	LTLAPAINW	0.9953	0.9733	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:05	IRFELDLTL	0.9941	0.9912	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:02	LTLAPAINW	0.9856	0.9828	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:08	IRFELDLTL	0.9644	0.9896	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-A32:01	LTLAPAINW	0.9634	0.9933	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:17	IRFELDLTL	0.962	0.9767	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:02	IRFELDLTL	0.948	0.9629	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:04	IRFELDLTL	0.9379	0.9638	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:13	LTLAPAINW	0.8793	0.9708	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:22	IRFELDLTL	0.8515	0.8856	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:09	IRFELDLTL	0.8401	0.6717	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:11	IRFELDLTL	0.7098	0.9343	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C03:67	IRFELDLTL	0.7074	0.986	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C18:01	IRFELDLTL	0.642	0.8857	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C04:04	IRFELDLTL	0.6046	0.9091	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:06	IRFELDLTL	0.5748	0.9908	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B53:02	LTLAPAINW	0.5519	0.8002	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:04	FELDLTLAP	0.5292	0.9612	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:05	FELDLTLAP	0.5292	0.9612	8	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B15:24	LTLAPAINW	0.4532	0.9847	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:02	IRFELDLTL	0.2496	0.9966	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:17	IRFELDLTL	0.2496	0.9966	6	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-A25:01	LTLAPAINW	0.0887	0.9747	12	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:17	FIRFELDLTL	0.9949	0.9902	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:02	FIRFELDLTL	0.9949	0.9902	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:10	FIRFELDLTL	0.9841	0.8661	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:08	FIRFELDLTL	0.9781	0.7943	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:06	FIRFELDLTL	0.9677	0.703	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:09	FIRFELDLTL	0.9466	0.8669	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:04	FELDLTLAPA	0.9372	0.9881	8	18
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:05	FELDLTLAPA	0.9372	0.9881	8	18
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:22	FIRFELDLTL	0.9094	0.7795	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C06:08	FIRFELDLTL	0.9079	0.9831	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-C07:01	FIRFELDLTL	0.8348	0.6461	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:04	RFELDLTLAP	0.8205	0.9123	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B50:05	RFELDLTLAP	0.8205	0.9123	7	17
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-A25:01	DLTLAPAINW	0.6999	0.9829	11	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:31	FIRFELDLTL	0.6331	0.8917	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:05	FIRFELDLTL	0.4692	0.9212	5	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:10	LDLTLAPAINW	0.9997	0.9942	10	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B57:04	LDLTLAPAINW	0.9987	0.9469	10	21
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:08	EFIRFELDLTL	0.9929	0.6534	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B27:09	EFIRFELDLTL	0.9885	0.7471	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B39:31	EFIRFELDLTL	0.825	0.7434	4	15
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	634	HLA-B38:05	EFIRFELDLTL	0.5969	0.7933	4	15

Top

Potential FusionNeoAntigen Information of PLEKHM2-ECE1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PLEKHM2-ECE1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3941	IRFELDLTLAPAIN	PLEKHM2	ECE1	chr1	16045120	chr1	21573856	634

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PLEKHM2-ECE1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3941	IRFELDLTLAPAIN	-7.9962	-8.1096
HLA-B14:02	3BVN	3941	IRFELDLTLAPAIN	-5.70842	-6.74372
HLA-B52:01	3W39	3941	IRFELDLTLAPAIN	-6.83737	-6.95077
HLA-B52:01	3W39	3941	IRFELDLTLAPAIN	-4.4836	-5.5189
HLA-A11:01	4UQ2	3941	IRFELDLTLAPAIN	-10.0067	-10.1201
HLA-A11:01	4UQ2	3941	IRFELDLTLAPAIN	-9.03915	-10.0745
HLA-A24:02	5HGA	3941	IRFELDLTLAPAIN	-6.56204	-6.67544
HLA-A24:02	5HGA	3941	IRFELDLTLAPAIN	-5.42271	-6.45801
HLA-B44:05	3DX8	3941	IRFELDLTLAPAIN	-7.85648	-8.89178
HLA-B44:05	3DX8	3941	IRFELDLTLAPAIN	-5.3978	-5.5112
HLA-A02:01	6TDR	3941	IRFELDLTLAPAIN	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PLEKHM2-ECE1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	10	21	LDLTLAPAINW	CTGGATCTGACCTTGGCACCCGCCATCAACTGG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	11	21	DLTLAPAINW	GATCTGACCTTGGCACCCGCCATCAACTGG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	12	21	LTLAPAINW	CTGACCTTGGCACCCGCCATCAACTGG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	4	15	EFIRFELDLTL	GAGTTCATTCGTTTCGAGCTGGATCTGACCTTG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	5	15	FIRFELDLTL	TTCATTCGTTTCGAGCTGGATCTGACCTTG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	6	15	IRFELDLTL	ATTCGTTTCGAGCTGGATCTGACCTTG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	6	16	IRFELDLTLA	ATTCGTTTCGAGCTGGATCTGACCTTGGCA
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	6	17	IRFELDLTLAP	ATTCGTTTCGAGCTGGATCTGACCTTGGCACCC
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	7	15	RFELDLTL	CGTTTCGAGCTGGATCTGACCTTG
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	7	17	RFELDLTLAP	CGTTTCGAGCTGGATCTGACCTTGGCACCC
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	8	16	FELDLTLA	TTCGAGCTGGATCTGACCTTGGCA
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	8	17	FELDLTLAP	TTCGAGCTGGATCTGACCTTGGCACCC
PLEKHM2-ECE1	chr1	16045120	chr1	21573856	8	18	FELDLTLAPA	TTCGAGCTGGATCTGACCTTGGCACCCGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PLEKHM2-ECE1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	PLEKHM2-ECE1	chr1	16045120	ENST00000375793	chr1	21573856	ENST00000264205	TCGA-DX-A8BV-01A

Top

Potential target of CAR-T therapy development for PLEKHM2-ECE1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PLEKHM2-ECE1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PLEKHM2-ECE1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)