![]() |
|||||||
|
Fusion Protein:POFUT1-HCK |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: POFUT1-HCK | FusionPDB ID: 66835 | FusionGDB2.0 ID: 66835 | Hgene | Tgene | Gene symbol | POFUT1 | HCK | Gene ID | 23509 | 3055 |
Gene name | protein O-fucosyltransferase 1 | HCK proto-oncogene, Src family tyrosine kinase | |
Synonyms | DDD2|FUT12|O-FUT|O-Fuc-T|O-FucT-1|OFUCT1 | JTK9|p59Hck|p61Hck | |
Cytomap | 20q11.21 | 20q11.21 | |
Type of gene | protein-coding | protein-coding | |
Description | GDP-fucose protein O-fucosyltransferase 1o-fucosyltransferase proteinpeptide-O-fucosyltransferase 1 | tyrosine-protein kinase HCKhematopoietic cell kinasehemopoietic cell kinasep59-HCK/p60-HCK | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | . | P08631 Main function of 5'-partner protein: FUNCTION: Non-receptor tyrosine-protein kinase found in hematopoietic cells that transmits signals from cell surface receptors and plays an important role in the regulation of innate immune responses, including neutrophil, monocyte, macrophage and mast cell functions, phagocytosis, cell survival and proliferation, cell adhesion and migration. Acts downstream of receptors that bind the Fc region of immunoglobulins, such as FCGR1A and FCGR2A, but also CSF3R, PLAUR, the receptors for IFNG, IL2, IL6 and IL8, and integrins, such as ITGB1 and ITGB2. During the phagocytic process, mediates mobilization of secretory lysosomes, degranulation, and activation of NADPH oxidase to bring about the respiratory burst. Plays a role in the release of inflammatory molecules. Promotes reorganization of the actin cytoskeleton and actin polymerization, formation of podosomes and cell protrusions. Inhibits TP73-mediated transcription activation and TP73-mediated apoptosis. Phosphorylates CBL in response to activation of immunoglobulin gamma Fc region receptors. Phosphorylates ADAM15, BCR, ELMO1, FCGR2A, GAB1, GAB2, RAPGEF1, STAT5B, TP73, VAV1 and WAS. {ECO:0000269|PubMed:10092522, ECO:0000269|PubMed:10779760, ECO:0000269|PubMed:10973280, ECO:0000269|PubMed:11741929, ECO:0000269|PubMed:11896602, ECO:0000269|PubMed:12411494, ECO:0000269|PubMed:15010462, ECO:0000269|PubMed:15952790, ECO:0000269|PubMed:15998323, ECO:0000269|PubMed:17310994, ECO:0000269|PubMed:17535448, ECO:0000269|PubMed:19114024, ECO:0000269|PubMed:19903482, ECO:0000269|PubMed:20452982, ECO:0000269|PubMed:21338576, ECO:0000269|PubMed:7535819, ECO:0000269|PubMed:8132624, ECO:0000269|PubMed:9406996, ECO:0000269|PubMed:9407116}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000486717, ENST00000539210, ENST00000375749, ENST00000375730, | ENST00000375852, ENST00000375862, ENST00000518730, ENST00000520553, ENST00000534862, ENST00000538448, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 5 X 7=245 | 10 X 10 X 7=700 |
# samples | 9 | 14 | |
** MAII score | log2(9/245*10)=-1.4447848426729 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(14/700*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: POFUT1 [Title/Abstract] AND HCK [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: POFUT1 [Title/Abstract] AND HCK [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | POFUT1(30818864)-HCK(30689120), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. POFUT1-HCK seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | POFUT1 | GO:0006493 | protein O-linked glycosylation | 9023546|11524432 |
Hgene | POFUT1 | GO:0036066 | protein O-linked fucosylation | 15653671 |
Tgene | HCK | GO:0071801 | regulation of podosome assembly | 15998323 |
Tgene | HCK | GO:2000251 | positive regulation of actin cytoskeleton reorganization | 15998323 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:30818864/chr20:30689120) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000375749 | POFUT1 | chr20 | 30818864 | + | ENST00000534862 | HCK | chr20 | 30689120 | + | 1576 | 1040 | 26 | 1060 | 344 |
ENST00000375749 | POFUT1 | chr20 | 30818864 | + | ENST00000538448 | HCK | chr20 | 30689120 | + | 1576 | 1040 | 26 | 1060 | 344 |
ENST00000375749 | POFUT1 | chr20 | 30818864 | + | ENST00000375862 | HCK | chr20 | 30689120 | + | 1243 | 1040 | 26 | 1060 | 344 |
ENST00000375749 | POFUT1 | chr20 | 30818864 | + | ENST00000518730 | HCK | chr20 | 30689120 | + | 1243 | 1040 | 26 | 1060 | 344 |
ENST00000539210 | POFUT1 | chr20 | 30818864 | + | ENST00000534862 | HCK | chr20 | 30689120 | + | 1145 | 609 | 132 | 629 | 165 |
ENST00000539210 | POFUT1 | chr20 | 30818864 | + | ENST00000538448 | HCK | chr20 | 30689120 | + | 1145 | 609 | 132 | 629 | 165 |
ENST00000539210 | POFUT1 | chr20 | 30818864 | + | ENST00000375862 | HCK | chr20 | 30689120 | + | 812 | 609 | 132 | 629 | 165 |
ENST00000539210 | POFUT1 | chr20 | 30818864 | + | ENST00000518730 | HCK | chr20 | 30689120 | + | 812 | 609 | 132 | 629 | 165 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000534862 | HCK | chr20 | 30671697 | + | 1568 | 186 | 26 | 1234 | 402 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000538448 | HCK | chr20 | 30671697 | + | 1568 | 186 | 26 | 1234 | 402 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000375862 | HCK | chr20 | 30671697 | + | 1235 | 186 | 26 | 1234 | 403 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000520553 | HCK | chr20 | 30671697 | + | 1572 | 186 | 26 | 1234 | 402 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000518730 | HCK | chr20 | 30671697 | + | 1235 | 186 | 26 | 1234 | 403 |
ENST00000375749 | POFUT1 | chr20 | 30795868 | + | ENST00000375852 | HCK | chr20 | 30671697 | + | 1572 | 186 | 26 | 1234 | 402 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000534862 | HCK | chr20 | 30671697 | + | 1555 | 173 | 13 | 1221 | 402 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000538448 | HCK | chr20 | 30671697 | + | 1555 | 173 | 13 | 1221 | 402 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000375862 | HCK | chr20 | 30671697 | + | 1222 | 173 | 13 | 1221 | 403 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000520553 | HCK | chr20 | 30671697 | + | 1559 | 173 | 13 | 1221 | 402 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000518730 | HCK | chr20 | 30671697 | + | 1222 | 173 | 13 | 1221 | 403 |
ENST00000375730 | POFUT1 | chr20 | 30795868 | + | ENST00000375852 | HCK | chr20 | 30671697 | + | 1559 | 173 | 13 | 1221 | 402 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000375749 | ENST00000534862 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.08922881 | 0.9107712 |
ENST00000375749 | ENST00000538448 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.08922881 | 0.9107712 |
ENST00000375749 | ENST00000375862 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.12722719 | 0.8727728 |
ENST00000375749 | ENST00000518730 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.12722719 | 0.8727728 |
ENST00000539210 | ENST00000534862 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.07041362 | 0.9295864 |
ENST00000539210 | ENST00000538448 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.07041362 | 0.9295864 |
ENST00000539210 | ENST00000375862 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.05317785 | 0.9468222 |
ENST00000539210 | ENST00000518730 | POFUT1 | chr20 | 30818864 | + | HCK | chr20 | 30689120 | + | 0.05317785 | 0.9468222 |
ENST00000375749 | ENST00000534862 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008371824 | 0.99162817 |
ENST00000375749 | ENST00000538448 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008371824 | 0.99162817 |
ENST00000375749 | ENST00000375862 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.009377508 | 0.99062246 |
ENST00000375749 | ENST00000520553 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008173939 | 0.99182606 |
ENST00000375749 | ENST00000518730 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.009377508 | 0.99062246 |
ENST00000375749 | ENST00000375852 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008173939 | 0.99182606 |
ENST00000375730 | ENST00000534862 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.007787737 | 0.9922123 |
ENST00000375730 | ENST00000538448 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.007787737 | 0.9922123 |
ENST00000375730 | ENST00000375862 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008713197 | 0.9912868 |
ENST00000375730 | ENST00000520553 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.007601149 | 0.9923989 |
ENST00000375730 | ENST00000518730 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.008713197 | 0.9912868 |
ENST00000375730 | ENST00000375852 | POFUT1 | chr20 | 30795868 | + | HCK | chr20 | 30671697 | + | 0.007601149 | 0.9923989 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for POFUT1-HCK |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
POFUT1 | chr20 | 30795868 | HCK | chr20 | 30671697 | 173 | 53 | WDPAGYLLYCPCMGSYSLSVRDYDPR |
POFUT1 | chr20 | 30795868 | HCK | chr20 | 30671697 | 186 | 53 | WDPAGYLLYCPCMGSYSLSVRDYDPR |
Top |
Potential FusionNeoAntigen Information of POFUT1-HCK in HLA I |
![]() |
POFUT1-HCK_30795868_30671697.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:03 | CPCMGSYSL | 0.9701 | 0.8704 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:02 | CPCMGSYSL | 0.8931 | 0.8783 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:04 | CPCMGSYSL | 0.8931 | 0.8783 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:03 | YCPCMGSYSL | 0.7145 | 0.8648 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:04 | YCPCMGSYSL | 0.595 | 0.8588 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:02 | YCPCMGSYSL | 0.595 | 0.8588 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:12 | CPCMGSYSL | 0.8931 | 0.8783 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B39:10 | CPCMGSYSL | 0.8209 | 0.9278 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-C01:17 | YCPCMGSYSL | 0.8307 | 0.9443 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-C01:30 | YCPCMGSYSL | 0.7631 | 0.9617 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:12 | YCPCMGSYSL | 0.595 | 0.8588 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:09 | CPCMGSYSL | 0.8931 | 0.8783 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B67:01 | CPCMGSYSL | 0.8733 | 0.7961 | 9 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-C01:02 | YCPCMGSYSL | 0.7716 | 0.9433 | 8 | 18 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | HLA-B35:09 | YCPCMGSYSL | 0.595 | 0.8588 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of POFUT1-HCK in HLA II |
![]() |
POFUT1-HCK_30795868_30671697.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-0829 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1303 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-13101 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1310 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1312 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1333 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1349 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1366 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1388 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1390 | CMGSYSLSVRDYDPR | 11 | 26 |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 173 | DRB1-1395 | CMGSYSLSVRDYDPR | 11 | 26 |
Top |
Fusion breakpoint peptide structures of POFUT1-HCK |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
5292 | LLYCPCMGSYSLSV | POFUT1 | HCK | chr20 | 30795868 | chr20 | 30671697 | 173 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of POFUT1-HCK |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 5292 | LLYCPCMGSYSLSV | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 5292 | LLYCPCMGSYSLSV | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 5292 | LLYCPCMGSYSLSV | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 5292 | LLYCPCMGSYSLSV | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 5292 | LLYCPCMGSYSLSV | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 5292 | LLYCPCMGSYSLSV | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 5292 | LLYCPCMGSYSLSV | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 5292 | LLYCPCMGSYSLSV | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 5292 | LLYCPCMGSYSLSV | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 5292 | LLYCPCMGSYSLSV | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 5292 | LLYCPCMGSYSLSV | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of POFUT1-HCK |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 8 | 18 | YCPCMGSYSL | ACTGCCCCTGCATGGGAAGCTACTCTTTGT |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 9 | 18 | CPCMGSYSL | GCCCCTGCATGGGAAGCTACTCTTTGT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
POFUT1-HCK | chr20 | 30795868 | chr20 | 30671697 | 11 | 26 | CMGSYSLSVRDYDPR | GCATGGGAAGCTACTCTTTGTCCGTGCGAGACTACGACCCTCGGC |
Top |
Information of the samples that have these potential fusion neoantigens of POFUT1-HCK |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | POFUT1-HCK | chr20 | 30795868 | ENST00000375730 | chr20 | 30671697 | ENST00000375852 | TCGA-04-1517-01A |
Top |
Potential target of CAR-T therapy development for POFUT1-HCK |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to POFUT1-HCK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to POFUT1-HCK |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |