Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:POFUT1-HCK

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: POFUT1-HCK
	FusionPDB ID: 66835
	FusionGDB2.0 ID: 66835
		Hgene	Tgene
	Gene symbol	POFUT1	HCK
	Gene ID	23509	3055
	Gene name	protein O-fucosyltransferase 1	HCK proto-oncogene, Src family tyrosine kinase
	Synonyms	DDD2\|FUT12\|O-FUT\|O-Fuc-T\|O-FucT-1\|OFUCT1	JTK9\|p59Hck\|p61Hck
	Cytomap	20q11.21	20q11.21
	Type of gene	protein-coding	protein-coding
	Description	GDP-fucose protein O-fucosyltransferase 1o-fucosyltransferase proteinpeptide-O-fucosyltransferase 1	tyrosine-protein kinase HCKhematopoietic cell kinasehemopoietic cell kinasep59-HCK/p60-HCK
	Modification date	20200313	20200329
	UniProtAcc	.	P08631 Main function of 5'-partner protein: FUNCTION: Non-receptor tyrosine-protein kinase found in hematopoietic cells that transmits signals from cell surface receptors and plays an important role in the regulation of innate immune responses, including neutrophil, monocyte, macrophage and mast cell functions, phagocytosis, cell survival and proliferation, cell adhesion and migration. Acts downstream of receptors that bind the Fc region of immunoglobulins, such as FCGR1A and FCGR2A, but also CSF3R, PLAUR, the receptors for IFNG, IL2, IL6 and IL8, and integrins, such as ITGB1 and ITGB2. During the phagocytic process, mediates mobilization of secretory lysosomes, degranulation, and activation of NADPH oxidase to bring about the respiratory burst. Plays a role in the release of inflammatory molecules. Promotes reorganization of the actin cytoskeleton and actin polymerization, formation of podosomes and cell protrusions. Inhibits TP73-mediated transcription activation and TP73-mediated apoptosis. Phosphorylates CBL in response to activation of immunoglobulin gamma Fc region receptors. Phosphorylates ADAM15, BCR, ELMO1, FCGR2A, GAB1, GAB2, RAPGEF1, STAT5B, TP73, VAV1 and WAS. {ECO:0000269\|PubMed:10092522, ECO:0000269\|PubMed:10779760, ECO:0000269\|PubMed:10973280, ECO:0000269\|PubMed:11741929, ECO:0000269\|PubMed:11896602, ECO:0000269\|PubMed:12411494, ECO:0000269\|PubMed:15010462, ECO:0000269\|PubMed:15952790, ECO:0000269\|PubMed:15998323, ECO:0000269\|PubMed:17310994, ECO:0000269\|PubMed:17535448, ECO:0000269\|PubMed:19114024, ECO:0000269\|PubMed:19903482, ECO:0000269\|PubMed:20452982, ECO:0000269\|PubMed:21338576, ECO:0000269\|PubMed:7535819, ECO:0000269\|PubMed:8132624, ECO:0000269\|PubMed:9406996, ECO:0000269\|PubMed:9407116}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000486717, ENST00000539210, ENST00000375749, ENST00000375730,	ENST00000375852, ENST00000375862, ENST00000518730, ENST00000520553, ENST00000534862, ENST00000538448,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 7=245	10 X 10 X 7=700
	# samples	9	14
	** MAII score	log2(9/245*10)=-1.4447848426729 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/700*10)=-2.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: POFUT1 [Title/Abstract] AND HCK [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: POFUT1 [Title/Abstract] AND HCK [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	POFUT1(30818864)-HCK(30689120), # samples:3
Anticipated loss of major functional domain due to fusion event.	POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. POFUT1-HCK seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. POFUT1-HCK seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	POFUT1	GO:0006493	protein O-linked glycosylation	9023546\|11524432
Hgene	POFUT1	GO:0036066	protein O-linked fucosylation	15653671
Tgene	HCK	GO:0071801	regulation of podosome assembly	15998323
Tgene	HCK	GO:2000251	positive regulation of actin cytoskeleton reorganization	15998323

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:30818864/chr20:30689120)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across POFUT1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across HCK (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000375749	POFUT1	chr20	30818864	+	ENST00000534862	HCK	chr20	30689120	+	1576	1040	26	1060	344
ENST00000375749	POFUT1	chr20	30818864	+	ENST00000538448	HCK	chr20	30689120	+	1576	1040	26	1060	344
ENST00000375749	POFUT1	chr20	30818864	+	ENST00000375862	HCK	chr20	30689120	+	1243	1040	26	1060	344
ENST00000375749	POFUT1	chr20	30818864	+	ENST00000518730	HCK	chr20	30689120	+	1243	1040	26	1060	344
ENST00000539210	POFUT1	chr20	30818864	+	ENST00000534862	HCK	chr20	30689120	+	1145	609	132	629	165
ENST00000539210	POFUT1	chr20	30818864	+	ENST00000538448	HCK	chr20	30689120	+	1145	609	132	629	165
ENST00000539210	POFUT1	chr20	30818864	+	ENST00000375862	HCK	chr20	30689120	+	812	609	132	629	165
ENST00000539210	POFUT1	chr20	30818864	+	ENST00000518730	HCK	chr20	30689120	+	812	609	132	629	165
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000534862	HCK	chr20	30671697	+	1568	186	26	1234	402
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000538448	HCK	chr20	30671697	+	1568	186	26	1234	402
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000375862	HCK	chr20	30671697	+	1235	186	26	1234	403
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000520553	HCK	chr20	30671697	+	1572	186	26	1234	402
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000518730	HCK	chr20	30671697	+	1235	186	26	1234	403
ENST00000375749	POFUT1	chr20	30795868	+	ENST00000375852	HCK	chr20	30671697	+	1572	186	26	1234	402
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000534862	HCK	chr20	30671697	+	1555	173	13	1221	402
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000538448	HCK	chr20	30671697	+	1555	173	13	1221	402
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000375862	HCK	chr20	30671697	+	1222	173	13	1221	403
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000520553	HCK	chr20	30671697	+	1559	173	13	1221	402
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000518730	HCK	chr20	30671697	+	1222	173	13	1221	403
ENST00000375730	POFUT1	chr20	30795868	+	ENST00000375852	HCK	chr20	30671697	+	1559	173	13	1221	402

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000375749	ENST00000534862	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.08922881	0.9107712
ENST00000375749	ENST00000538448	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.08922881	0.9107712
ENST00000375749	ENST00000375862	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.12722719	0.8727728
ENST00000375749	ENST00000518730	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.12722719	0.8727728
ENST00000539210	ENST00000534862	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.07041362	0.9295864
ENST00000539210	ENST00000538448	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.07041362	0.9295864
ENST00000539210	ENST00000375862	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.05317785	0.9468222
ENST00000539210	ENST00000518730	POFUT1	chr20	30818864	+	HCK	chr20	30689120	+	0.05317785	0.9468222
ENST00000375749	ENST00000534862	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008371824	0.99162817
ENST00000375749	ENST00000538448	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008371824	0.99162817
ENST00000375749	ENST00000375862	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.009377508	0.99062246
ENST00000375749	ENST00000520553	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008173939	0.99182606
ENST00000375749	ENST00000518730	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.009377508	0.99062246
ENST00000375749	ENST00000375852	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008173939	0.99182606
ENST00000375730	ENST00000534862	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.007787737	0.9922123
ENST00000375730	ENST00000538448	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.007787737	0.9922123
ENST00000375730	ENST00000375862	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008713197	0.9912868
ENST00000375730	ENST00000520553	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.007601149	0.9923989
ENST00000375730	ENST00000518730	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.008713197	0.9912868
ENST00000375730	ENST00000375852	POFUT1	chr20	30795868	+	HCK	chr20	30671697	+	0.007601149	0.9923989

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for POFUT1-HCK

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
POFUT1	chr20	30795868	HCK	chr20	30671697	173	53	WDPAGYLLYCPCMGSYSLSVRDYDPR
POFUT1	chr20	30795868	HCK	chr20	30671697	186	53	WDPAGYLLYCPCMGSYSLSVRDYDPR

Top

Potential FusionNeoAntigen Information of POFUT1-HCK in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

POFUT1-HCK_30795868_30671697.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:03	CPCMGSYSL	0.9701	0.8704	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:02	CPCMGSYSL	0.8931	0.8783	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:04	CPCMGSYSL	0.8931	0.8783	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:03	YCPCMGSYSL	0.7145	0.8648	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:04	YCPCMGSYSL	0.595	0.8588	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:02	YCPCMGSYSL	0.595	0.8588	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:12	CPCMGSYSL	0.8931	0.8783	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B39:10	CPCMGSYSL	0.8209	0.9278	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-C01:17	YCPCMGSYSL	0.8307	0.9443	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-C01:30	YCPCMGSYSL	0.7631	0.9617	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:12	YCPCMGSYSL	0.595	0.8588	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:09	CPCMGSYSL	0.8931	0.8783	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B67:01	CPCMGSYSL	0.8733	0.7961	9	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-C01:02	YCPCMGSYSL	0.7716	0.9433	8	18
POFUT1-HCK	chr20	30795868	chr20	30671697	173	HLA-B35:09	YCPCMGSYSL	0.595	0.8588	8	18

Top

Potential FusionNeoAntigen Information of POFUT1-HCK in HLA II

POFUT1-HCK_30795868_30671697.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-0829	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1303	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-13101	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1310	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1312	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1333	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1349	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1366	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1388	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1390	CMGSYSLSVRDYDPR	11	26
POFUT1-HCK	chr20	30795868	chr20	30671697	173	DRB1-1395	CMGSYSLSVRDYDPR	11	26

Top

Fusion breakpoint peptide structures of POFUT1-HCK

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5292	LLYCPCMGSYSLSV	POFUT1	HCK	chr20	30795868	chr20	30671697	173

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of POFUT1-HCK

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5292	LLYCPCMGSYSLSV	-7.9962	-8.1096
HLA-B14:02	3BVN	5292	LLYCPCMGSYSLSV	-5.70842	-6.74372
HLA-B52:01	3W39	5292	LLYCPCMGSYSLSV	-6.83737	-6.95077
HLA-B52:01	3W39	5292	LLYCPCMGSYSLSV	-4.4836	-5.5189
HLA-A11:01	4UQ2	5292	LLYCPCMGSYSLSV	-10.0067	-10.1201
HLA-A11:01	4UQ2	5292	LLYCPCMGSYSLSV	-9.03915	-10.0745
HLA-A24:02	5HGA	5292	LLYCPCMGSYSLSV	-6.56204	-6.67544
HLA-A24:02	5HGA	5292	LLYCPCMGSYSLSV	-5.42271	-6.45801
HLA-B44:05	3DX8	5292	LLYCPCMGSYSLSV	-7.85648	-8.89178
HLA-B44:05	3DX8	5292	LLYCPCMGSYSLSV	-5.3978	-5.5112
HLA-A02:01	6TDR	5292	LLYCPCMGSYSLSV	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of POFUT1-HCK

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
POFUT1-HCK	chr20	30795868	chr20	30671697	8	18	YCPCMGSYSL	ACTGCCCCTGCATGGGAAGCTACTCTTTGT
POFUT1-HCK	chr20	30795868	chr20	30671697	9	18	CPCMGSYSL	GCCCCTGCATGGGAAGCTACTCTTTGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
POFUT1-HCK	chr20	30795868	chr20	30671697	11	26	CMGSYSLSVRDYDPR	GCATGGGAAGCTACTCTTTGTCCGTGCGAGACTACGACCCTCGGC

Top

Information of the samples that have these potential fusion neoantigens of POFUT1-HCK

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	POFUT1-HCK	chr20	30795868	ENST00000375730	chr20	30671697	ENST00000375852	TCGA-04-1517-01A

Top

Potential target of CAR-T therapy development for POFUT1-HCK

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to POFUT1-HCK

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to POFUT1-HCK

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)