|
|||||||
|
Fusion Protein:ARNT-MRPL52 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ARNT-MRPL52 | FusionPDB ID: 6755 | FusionGDB2.0 ID: 6755 | Hgene | Tgene | Gene symbol | ARNT | MRPL52 | Gene ID | 375056 | 122704 |
| Gene name | MIA SH3 domain ER export factor 3 | mitochondrial ribosomal protein L52 | |
| Synonyms | ARNT|D320|TANGO|TANGO1|UNQ6077 | - | |
| Cytomap | 1q41 | 14q11.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | transport and Golgi organization protein 1 homologC219-reactive peptideMIA family member 3, ER export factormelanoma inhibitory activity family, member 3melanoma inhibitory activity protein 3transport and Golgi organization protein 1 | 39S ribosomal protein L52, mitochondrialL52mtMRP-L52mitochondrial large ribosomal subunit protein mL52 | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q8WYA1 Main function of 5'-partner protein: FUNCTION: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1. {ECO:0000269|PubMed:11018023, ECO:0000269|PubMed:12738229, ECO:0000269|PubMed:14672706}. | Q86TS9 Main function of 5'-partner protein: | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000354396, ENST00000358595, ENST00000505755, ENST00000515192, ENST00000468970, | ENST00000461594, ENST00000555536, ENST00000355151, ENST00000397496, ENST00000397505, ENST00000432849, ENST00000553711, ENST00000555345, ENST00000556840, ENST00000557221, ENST00000311892, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 18 X 16 X 9=2592 | 6 X 4 X 5=120 |
| # samples | 18 | 6 | |
| ** MAII score | log2(18/2592*10)=-3.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/120*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ARNT [Title/Abstract] AND MRPL52 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ARNT [Title/Abstract] AND MRPL52 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ARNT(150818739)-MRPL52(23303381), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | ARNT-MRPL52 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARNT-MRPL52 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ARNT-MRPL52 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. ARNT-MRPL52 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. ARNT-MRPL52 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ARNT | GO:0002687 | positive regulation of leukocyte migration | 17726152 |
| Hgene | ARNT | GO:0007162 | negative regulation of cell adhesion | 17726152 |
| Hgene | ARNT | GO:0030336 | negative regulation of cell migration | 17044017 |
| Hgene | ARNT | GO:0042060 | wound healing | 17044017 |
Four levels of functional features of fusion genesGo to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:150818739/chr14:23303381) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across ARNT (5'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion gene breakpoints across MRPL52 (3'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000358595 | ARNT | chr1 | 150818739 | - | ENST00000311892 | MRPL52 | chr14 | 23303381 | + | 1234 | 428 | 102 | 554 | 150 |
| ENST00000354396 | ARNT | chr1 | 150818739 | - | ENST00000311892 | MRPL52 | chr14 | 23303381 | + | 1045 | 239 | 12 | 365 | 117 |
| ENST00000515192 | ARNT | chr1 | 150818739 | - | ENST00000555345 | MRPL52 | chr14 | 23303381 | + | 970 | 424 | 167 | 550 | 127 |
| ENST00000515192 | ARNT | chr1 | 150818739 | - | ENST00000553711 | MRPL52 | chr14 | 23303381 | + | 598 | 424 | 167 | 550 | 127 |
| ENST00000515192 | ARNT | chr1 | 150818739 | - | ENST00000397505 | MRPL52 | chr14 | 23303381 | + | 600 | 424 | 167 | 550 | 127 |
| ENST00000515192 | ARNT | chr1 | 150818739 | - | ENST00000557221 | MRPL52 | chr14 | 23303381 | + | 1081 | 424 | 167 | 550 | 127 |
| ENST00000505755 | ARNT | chr1 | 150818739 | - | ENST00000311892 | MRPL52 | chr14 | 23303381 | + | 1075 | 269 | 42 | 395 | 117 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000358595 | ENST00000311892 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.033752687 | 0.96624726 |
| ENST00000354396 | ENST00000311892 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.056113224 | 0.9438868 |
| ENST00000515192 | ENST00000555345 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.049943518 | 0.95005643 |
| ENST00000515192 | ENST00000553711 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.016320972 | 0.983679 |
| ENST00000515192 | ENST00000397505 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.016514996 | 0.98348504 |
| ENST00000515192 | ENST00000557221 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.0463266 | 0.9536734 |
| ENST00000505755 | ENST00000311892 | ARNT | chr1 | 150818739 | - | MRPL52 | chr14 | 23303381 | + | 0.050942823 | 0.94905716 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ARNT-MRPL52 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ARNT | chr1 | 150818739 | MRPL52 | chr14 | 23303381 | 239 | 75 | DDDQMSNDKERFARDELYCCHRKWTL |
| ARNT | chr1 | 150818739 | MRPL52 | chr14 | 23303381 | 269 | 75 | DDDQMSNDKERFARDELYCCHRKWTL |
| ARNT | chr1 | 150818739 | MRPL52 | chr14 | 23303381 | 424 | 85 | DDDQMSNDKERFARDELYCCHRKWTL |
| ARNT | chr1 | 150818739 | MRPL52 | chr14 | 23303381 | 428 | 108 | DDDQMSNDKERFARDELYCCHRKWTL |
Top |
Potential FusionNeoAntigen Information of ARNT-MRPL52 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ARNT-MRPL52_150818739_23303381.msa |
Potential FusionNeoAntigen Information* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B14:01 | ERFARDEL | 0.9995 | 0.5959 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B14:02 | ERFARDEL | 0.9995 | 0.5959 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B15:37 | ERFARDEL | 0.9762 | 0.5148 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B39:13 | KERFARDEL | 0.3784 | 0.8339 | 8 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B44:03 | KERFARDELY | 0.9991 | 0.8703 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B27:05 | KERFARDELY | 0.9914 | 0.7175 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B39:12 | ERFARDEL | 0.9985 | 0.8216 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B14:03 | ERFARDEL | 0.9747 | 0.8007 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:27 | ERFARDELY | 0.9706 | 0.87 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:46 | ERFARDELY | 0.7873 | 0.688 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:67 | ERFARDELY | 0.7785 | 0.859 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:80 | ERFARDELY | 0.7785 | 0.859 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:10 | ERFARDELY | 0.7647 | 0.8841 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B39:08 | KERFARDEL | 0.5095 | 0.5899 | 8 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C12:16 | ERFARDELY | 0.053 | 0.9018 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B27:03 | KERFARDELY | 0.8466 | 0.7641 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B39:31 | ERFARDEL | 0.9988 | 0.8112 | 9 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B40:04 | KERFARDEL | 0.9951 | 0.6703 | 8 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-C07:02 | ERFARDELY | 0.7785 | 0.859 | 9 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B39:02 | KERFARDEL | 0.5082 | 0.8406 | 8 | 17 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B44:07 | KERFARDELY | 0.9991 | 0.8703 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B44:13 | KERFARDELY | 0.9991 | 0.8703 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B44:26 | KERFARDELY | 0.9991 | 0.8703 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B27:10 | KERFARDELY | 0.9878 | 0.6432 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B15:53 | KERFARDELY | 0.9723 | 0.7033 | 8 | 18 |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 | HLA-B48:02 | KERFARDELY | 0.8792 | 0.7536 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of ARNT-MRPL52 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ARNT-MRPL52 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 6110 | NDKERFARDELYCC | ARNT | MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 239 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARNT-MRPL52 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens* We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 6110 | NDKERFARDELYCC | -7.75776 | -7.86956 |
| HLA-B14:02 | 3BVN | 6110 | NDKERFARDELYCC | -4.52646 | -5.56956 |
| HLA-B52:01 | 3W39 | 6110 | NDKERFARDELYCC | -7.1873 | -7.2991 |
| HLA-B52:01 | 3W39 | 6110 | NDKERFARDELYCC | -2.81174 | -3.85484 |
| HLA-A11:01 | 4UQ2 | 6110 | NDKERFARDELYCC | -5.13576 | -5.24756 |
| HLA-A24:02 | 5HGA | 6110 | NDKERFARDELYCC | -8.42076 | -8.53256 |
| HLA-A24:02 | 5HGA | 6110 | NDKERFARDELYCC | -7.10496 | -8.14806 |
| HLA-B27:05 | 6PYJ | 6110 | NDKERFARDELYCC | -9.28296 | -9.39476 |
| HLA-B44:05 | 3DX8 | 6110 | NDKERFARDELYCC | -6.88262 | -6.99442 |
| HLA-B44:05 | 3DX8 | 6110 | NDKERFARDELYCC | -5.46822 | -6.51132 |
Top |
Vaccine Design for the FusionNeoAntigens of ARNT-MRPL52 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 8 | 17 | KERFARDEL | GGAGCGGTTTGCCAGAGACGAGTTGTA |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 8 | 18 | KERFARDELY | GGAGCGGTTTGCCAGAGACGAGTTGTACTG |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 9 | 17 | ERFARDEL | GCGGTTTGCCAGAGACGAGTTGTA |
| ARNT-MRPL52 | chr1 | 150818739 | chr14 | 23303381 | 9 | 18 | ERFARDELY | GCGGTTTGCCAGAGACGAGTTGTACTG |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ARNT-MRPL52 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| KICH | ARNT-MRPL52 | chr1 | 150818739 | ENST00000354396 | chr14 | 23303381 | ENST00000311892 | TCGA-KO-8404-01A |
Top |
Potential target of CAR-T therapy development for ARNT-MRPL52 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features* Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ARNT-MRPL52 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ARNT-MRPL52 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |