Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PPP2R4-NUP188

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PPP2R4-NUP188
	FusionPDB ID: 68055
	FusionGDB2.0 ID: 68055
		Hgene	Tgene
	Gene symbol	PPP2R4	NUP188
	Gene ID	5524	23511
	Gene name	protein phosphatase 2 phosphatase activator	nucleoporin 188
	Synonyms	PP2A\|PPP2R4\|PR53	KIAA0169\|SANDSTEF\|hNup188
	Cytomap	9q34.11	9q34.11
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein phosphatase 2A activatorPP2A phosphatase activatorPP2A subunit B' isoform PR53phosphotyrosyl phosphatase activatorprotein phosphatase 2 regulatory subunit 4protein phosphatase 2A activator, regulatory subunit 4protein phosph	nucleoporin NUP188 homolognucleoporin 188kDa
	Modification date	20200329	20200314
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000337738, ENST00000348141, ENST00000357197, ENST00000358994, ENST00000393370, ENST00000452489, ENST00000347048, ENST00000355007, ENST00000414510, ENST00000419582, ENST00000423100, ENST00000432124, ENST00000432651, ENST00000434095, ENST00000435132, ENST00000435305, ENST00000436883, ENST00000524946,	ENST00000550219, ENST00000372577,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 9 X 8=720	4 X 6 X 3=72
	# samples	12	6
	** MAII score	log2(12/720*10)=-2.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/72*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PPP2R4 [Title/Abstract] AND NUP188 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PPP2R4 [Title/Abstract] AND NUP188 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PPP2R4(131891389)-NUP188(131730785), # samples:2
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PPP2R4	GO:0032515	negative regulation of phosphoprotein phosphatase activity	16916641
Hgene	PPP2R4	GO:0032516	positive regulation of phosphoprotein phosphatase activity	16916641
Hgene	PPP2R4	GO:0035307	positive regulation of protein dephosphorylation	16916641
Hgene	PPP2R4	GO:0035308	negative regulation of protein dephosphorylation	16916641
Hgene	PPP2R4	GO:0043065	positive regulation of apoptotic process	17333320
Hgene	PPP2R4	GO:0043666	regulation of phosphoprotein phosphatase activity	16916641

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr9:131891389/chr9:131730785)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PPP2R4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NUP188 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000358994	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5637	554	8	5218	1736
ENST00000393370	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5708	625	169	5289	1706
ENST00000337738	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5797	714	153	5378	1741
ENST00000348141	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5708	625	151	5289	1712
ENST00000452489	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5743	660	99	5324	1741
ENST00000357197	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730784	+	5530	447	78	5111	1677
ENST00000358994	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5637	554	8	5218	1736
ENST00000393370	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5708	625	169	5289	1706
ENST00000337738	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5797	714	153	5378	1741
ENST00000348141	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5708	625	151	5289	1712
ENST00000452489	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5743	660	99	5324	1741
ENST00000357197	PPP2R4	chr9	131891389	+	ENST00000372577	NUP188	chr9	131730785	+	5530	447	78	5111	1677

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000358994	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.002899086	0.9971009
ENST00000393370	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.003421533	0.9965785
ENST00000337738	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.003506689	0.9964933
ENST00000348141	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.003328891	0.99667114
ENST00000452489	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.003479133	0.9965209
ENST00000357197	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730784	+	0.003442219	0.9965578
ENST00000358994	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.002899086	0.9971009
ENST00000393370	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.003421533	0.9965785
ENST00000337738	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.003506689	0.9964933
ENST00000348141	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.003328891	0.99667114
ENST00000452489	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.003479133	0.9965209
ENST00000357197	ENST00000372577	PPP2R4	chr9	131891389	+	NUP188	chr9	131730785	+	0.003442219	0.9965578

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PPP2R4-NUP188

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PPP2R4	chr9	131891389	NUP188	chr9	131730784	447	123	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730784	554	182	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730784	625	152	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730784	625	158	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730784	660	187	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730784	714	187	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	447	123	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	554	182	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	625	152	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	625	158	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	660	187	NKAYRTWYAKLDETERQVSRWFVQCL
PPP2R4	chr9	131891389	NUP188	chr9	131730785	714	187	NKAYRTWYAKLDETERQVSRWFVQCL

Top

Potential FusionNeoAntigen Information of PPP2R4-NUP188 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PPP2R4-NUP188_131891389_131730784.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:60	KLDETERQV	0.9972	0.7055	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:67	KLDETERQV	0.997	0.6893	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:30	KLDETERQV	0.997	0.6893	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:24	KLDETERQV	0.997	0.6893	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:11	KLDETERQV	0.9967	0.7062	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:16	KLDETERQV	0.9954	0.6443	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:04	KLDETERQV	0.9946	0.8299	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:21	KLDETERQV	0.9944	0.7731	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:22	KLDETERQV	0.9933	0.6904	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:17	KLDETERQV	0.993	0.7501	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:38	KLDETERQV	0.9922	0.7137	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:27	KLDETERQV	0.9904	0.6563	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:13	KLDETERQV	0.9873	0.7326	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B57:01	ETERQVSRW	0.9788	0.8027	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:35	KLDETERQV	0.9524	0.7229	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B58:02	ETERQVSRW	0.9127	0.7879	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B58:01	ETERQVSRW	0.8884	0.729	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:29	KLDETERQV	0.8846	0.6947	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:20	KLDETERQV	0.8603	0.6963	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B13:02	KLDETERQV	0.3807	0.8661	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B44:03	DETERQVSRW	0.9996	0.9539	11	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:27	AKLDETERQV	0.6185	0.676	8	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:01	DETERQVSRWF	0.9948	0.7834	11	22
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A74:09	KLDETERQVSR	0.9936	0.8759	9	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A74:11	KLDETERQVSR	0.9936	0.8759	9	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A74:03	KLDETERQVSR	0.9936	0.8759	9	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:35	YAKLDETERQV	0.9773	0.7139	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:16	YAKLDETERQV	0.9492	0.6903	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:27	YAKLDETERQV	0.945	0.6579	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:60	YAKLDETERQV	0.9434	0.6595	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:30	YAKLDETERQV	0.9373	0.6847	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:67	YAKLDETERQV	0.9373	0.6847	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:24	YAKLDETERQV	0.9373	0.6847	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:19	YAKLDETERQV	0.9359	0.5807	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:29	YAKLDETERQV	0.9313	0.6894	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:20	YAKLDETERQV	0.9312	0.6901	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:11	YAKLDETERQV	0.9286	0.7007	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:13	YAKLDETERQV	0.9246	0.722	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:38	YAKLDETERQV	0.9092	0.7195	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C05:09	KLDETERQV	0.9999	0.9674	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:10	KLDETERQV	0.9997	0.9573	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:07	KLDETERQV	0.9992	0.9536	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C08:15	KLDETERQV	0.9973	0.984	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:01	KLDETERQV	0.997	0.6893	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:07	KLDETERQV	0.9969	0.7192	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:02	KLDETERQV	0.993	0.5175	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:06	KLDETERQV	0.993	0.971	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:05	KLDETERQV	0.9913	0.624	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:14	KLDETERQV	0.9079	0.9501	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C05:09	YAKLDETERQV	0.9997	0.9753	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C08:15	YAKLDETERQV	0.9965	0.9857	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:07	YAKLDETERQV	0.9465	0.7209	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:01	YAKLDETERQV	0.9373	0.6847	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:03	KLDETERQV	0.9999	0.9523	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C05:01	KLDETERQV	0.9999	0.9674	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C18:01	KLDETERQV	0.9998	0.9545	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:01	KLDETERQV	0.9992	0.9536	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C08:02	KLDETERQV	0.9973	0.984	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:06	KLDETERQV	0.9944	0.7731	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:14	KLDETERQV	0.9944	0.7214	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A02:03	KLDETERQV	0.9884	0.7602	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B57:10	ETERQVSRW	0.9788	0.8027	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C04:04	KLDETERQV	0.9565	0.9732	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A25:01	ETERQVSRW	0.8738	0.7637	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:03	DETERQVSR	0.8709	0.807	11	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:06	DETERQVSR	0.8681	0.8505	11	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B57:02	ETERQVSRW	0.7853	0.7369	12	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C07:04	KLDETERQV	0.1403	0.9835	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B07:13	KLDETERQV	0.0199	0.834	9	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B44:26	DETERQVSRW	0.9996	0.9539	11	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B44:13	DETERQVSRW	0.9996	0.9539	11	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B44:07	DETERQVSRW	0.9996	0.9539	11	21
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C05:01	YAKLDETERQV	0.9997	0.9753	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-C08:02	YAKLDETERQV	0.9965	0.9857	7	18
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:08	DETERQVSRWF	0.9959	0.8116	11	22
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:05	DETERQVSRWF	0.9948	0.7834	11	22
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-A74:01	KLDETERQVSR	0.9936	0.8759	9	20
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	HLA-B18:03	DETERQVSRWF	0.9925	0.771	11	22

Top

Potential FusionNeoAntigen Information of PPP2R4-NUP188 in HLA II

PPP2R4-NUP188_131891389_131730784.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	DRB1-0486	NKAYRTWYAKLDETE	0	15
PPP2R4-NUP188	chr9	131891389	chr9	131730784	714	DRB1-0832	NKAYRTWYAKLDETE	0	15

Top

Fusion breakpoint peptide structures of PPP2R4-NUP188

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10565	WYAKLDETERQVSR	PPP2R4	NUP188	chr9	131891389	chr9	131730784	714

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PPP2R4-NUP188

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10565	WYAKLDETERQVSR	-7.15543	-7.26883
HLA-B14:02	3BVN	10565	WYAKLDETERQVSR	-4.77435	-5.80965
HLA-B52:01	3W39	10565	WYAKLDETERQVSR	-6.80875	-6.92215
HLA-B52:01	3W39	10565	WYAKLDETERQVSR	-4.20386	-5.23916
HLA-A11:01	4UQ2	10565	WYAKLDETERQVSR	-7.5194	-8.5547
HLA-A11:01	4UQ2	10565	WYAKLDETERQVSR	-6.9601	-7.0735
HLA-A24:02	5HGA	10565	WYAKLDETERQVSR	-7.52403	-7.63743
HLA-A24:02	5HGA	10565	WYAKLDETERQVSR	-5.82433	-6.85963
HLA-B27:05	6PYJ	10565	WYAKLDETERQVSR	-3.28285	-4.31815
HLA-B44:05	3DX8	10565	WYAKLDETERQVSR	-5.91172	-6.94702
HLA-B44:05	3DX8	10565	WYAKLDETERQVSR	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of PPP2R4-NUP188

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PPP2R4-NUP188	chr9	131891389	chr9	131730784	11	20	DETERQVSR	GATGAGACAGAGCGCCAAGTGTCTCGC
PPP2R4-NUP188	chr9	131891389	chr9	131730784	11	21	DETERQVSRW	GATGAGACAGAGCGCCAAGTGTCTCGCTGG
PPP2R4-NUP188	chr9	131891389	chr9	131730784	11	22	DETERQVSRWF	GATGAGACAGAGCGCCAAGTGTCTCGCTGGTTT
PPP2R4-NUP188	chr9	131891389	chr9	131730784	12	21	ETERQVSRW	GAGACAGAGCGCCAAGTGTCTCGCTGG
PPP2R4-NUP188	chr9	131891389	chr9	131730784	7	18	YAKLDETERQV	TATGCCAAACTTGATGAGACAGAGCGCCAAGTG
PPP2R4-NUP188	chr9	131891389	chr9	131730784	8	18	AKLDETERQV	GCCAAACTTGATGAGACAGAGCGCCAAGTG
PPP2R4-NUP188	chr9	131891389	chr9	131730784	9	18	KLDETERQV	AAACTTGATGAGACAGAGCGCCAAGTG
PPP2R4-NUP188	chr9	131891389	chr9	131730784	9	20	KLDETERQVSR	AAACTTGATGAGACAGAGCGCCAAGTGTCTCGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PPP2R4-NUP188	chr9	131891389	chr9	131730784	0	15	NKAYRTWYAKLDETE	AATAAGGCATACAGGACCTGGTATGCCAAACTTGATGAGACAGAG

Top

Information of the samples that have these potential fusion neoantigens of PPP2R4-NUP188

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	PPP2R4-NUP188	chr9	131891389	ENST00000337738	chr9	131730784	ENST00000372577	TCGA-AC-A23H

Top

Potential target of CAR-T therapy development for PPP2R4-NUP188

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PPP2R4-NUP188

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PPP2R4-NUP188

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)