Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PTBP2-PRKACB

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PTBP2-PRKACB
	FusionPDB ID: 69845
	FusionGDB2.0 ID: 69845
		Hgene	Tgene
	Gene symbol	PTBP2	PRKACB
	Gene ID	58155	5567
	Gene name	polypyrimidine tract binding protein 2	protein kinase cAMP-activated catalytic subunit beta
	Synonyms	PTBLP\|brPTB\|nPTB	PKA C-beta\|PKACB
	Cytomap	1p21.3	1p31.1
	Type of gene	protein-coding	protein-coding
	Description	polypyrimidine tract-binding protein 2PTB-like proteinneural polypyrimidine tract binding proteinneurally-enriched homolog of PTB	cAMP-dependent protein kinase catalytic subunit betacAMP-dependent protein kinase catalytic beta subunit isoform 4abprotein kinase A catalytic subunit betaprotein kinase, cAMP-dependent, beta catalytic subunitprotein kinase, cAMP-dependent, catalytic,
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000370197, ENST00000370198, ENST00000394184, ENST00000426398, ENST00000541987, ENST00000609116, ENST00000482253,	ENST00000370680, ENST00000470673, ENST00000370682, ENST00000370685, ENST00000370688, ENST00000370689, ENST00000394838, ENST00000394839,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 6 X 4=192	11 X 8 X 7=616
	# samples	9	12
	** MAII score	log2(9/192*10)=-1.09310940439148 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/616*10)=-2.35989594508638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PTBP2 [Title/Abstract] AND PRKACB [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PTBP2 [Title/Abstract] AND PRKACB [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PTBP2(97217056)-PRKACB(84644860), # samples:1
Anticipated loss of major functional domain due to fusion event.	PTBP2-PRKACB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTBP2-PRKACB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTBP2-PRKACB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PTBP2-PRKACB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PTBP2	GO:0033119	negative regulation of RNA splicing	18335065
Tgene	PRKACB	GO:0006468	protein phosphorylation	12420224\|21880142

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:97217056/chr1:84644860)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PTBP2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PRKACB (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4400	197	37	1206	389
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4400	197	37	1206	389
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4391	197	37	1206	389
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4391	197	37	1206	389
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4301	197	37	1107	356
ENST00000609116	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1874	197	37	924	295
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4373	170	10	1179	389
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4373	170	10	1179	389
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4364	170	10	1179	389
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4364	170	10	1179	389
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4274	170	10	1080	356
ENST00000370197	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1847	170	10	897	295
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4373	170	10	1179	389
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4373	170	10	1179	389
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4364	170	10	1179	389
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4364	170	10	1179	389
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4274	170	10	1080	356
ENST00000370198	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1847	170	10	897	295
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4361	158	28	1167	379
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4361	158	28	1167	379
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4352	158	28	1167	379
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4352	158	28	1167	379
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4262	158	28	1068	346
ENST00000426398	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1835	158	28	885	285
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4515	312	164	1321	385
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4515	312	164	1321	385
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4506	312	164	1321	385
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4506	312	164	1321	385
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4416	312	164	1222	352
ENST00000394184	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1989	312	164	1039	291
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000370689	PRKACB	chr1	84644860	+	4391	188	166	1197	343
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000370685	PRKACB	chr1	84644860	+	4391	188	166	1197	343
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000394838	PRKACB	chr1	84644860	+	4382	188	166	1197	343
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000370682	PRKACB	chr1	84644860	+	4382	188	166	1197	343
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000394839	PRKACB	chr1	84644860	+	4292	188	166	1098	310
ENST00000541987	PTBP2	chr1	97217056	+	ENST00000370688	PRKACB	chr1	84644860	+	1865	188	166	915	249

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000609116	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00037962	0.9996203
ENST00000609116	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00037962	0.9996203
ENST00000609116	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000387857	0.99961215
ENST00000609116	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000387857	0.99961215
ENST00000609116	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000208782	0.9997912
ENST00000609116	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000803725	0.99919623
ENST00000370197	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000384361	0.99961567
ENST00000370197	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000384361	0.99961567
ENST00000370197	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00039277	0.99960726
ENST00000370197	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00039277	0.99960726
ENST00000370197	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000211728	0.99978834
ENST00000370197	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000856581	0.99914336
ENST00000370198	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000384361	0.99961567
ENST00000370198	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000384361	0.99961567
ENST00000370198	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00039277	0.99960726
ENST00000370198	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.00039277	0.99960726
ENST00000370198	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000211728	0.99978834
ENST00000370198	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000856581	0.99914336
ENST00000426398	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000381132	0.9996189
ENST00000426398	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000381132	0.9996189
ENST00000426398	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000389562	0.9996105
ENST00000426398	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000389562	0.9996105
ENST00000426398	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000209709	0.99979025
ENST00000426398	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000760625	0.99923944
ENST00000394184	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	9.27E-05	0.99990726
ENST00000394184	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	9.27E-05	0.99990726
ENST00000394184	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	9.41E-05	0.99990594
ENST00000394184	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	9.41E-05	0.99990594
ENST00000394184	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	7.08E-05	0.9999292
ENST00000394184	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000182314	0.99981767
ENST00000541987	ENST00000370689	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000145891	0.9998541
ENST00000541987	ENST00000370685	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000145891	0.9998541
ENST00000541987	ENST00000394838	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000151671	0.99984825
ENST00000541987	ENST00000370682	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000151671	0.99984825
ENST00000541987	ENST00000394839	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	7.11E-05	0.99992883
ENST00000541987	ENST00000370688	PTBP2	chr1	97217056	+	PRKACB	chr1	84644860	+	0.000656937	0.9993431

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PTBP2-PRKACB

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PTBP2	chr1	97217056	PRKACB	chr1	84644860	158	43	SSPNSNMSSMVVTVKEFLAKAKEDFL
PTBP2	chr1	97217056	PRKACB	chr1	84644860	170	53	SSPNSNMSSMVVTVKEFLAKAKEDFL
PTBP2	chr1	97217056	PRKACB	chr1	84644860	197	53	SSPNSNMSSMVVTVKEFLAKAKEDFL
PTBP2	chr1	97217056	PRKACB	chr1	84644860	312	49	SSPNSNMSSMVVTVKEFLAKAKEDFL

Top

Potential FusionNeoAntigen Information of PTBP2-PRKACB in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PTBP2-PRKACB_97217056_84644860.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:01	SMVVTVKEF	0.9982	0.9607	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:22	NMSSMVVTV	0.9979	0.7181	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:13	NMSSMVVTV	0.9951	0.7457	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:27	NMSSMVVTV	0.9945	0.7082	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:02	SMVVTVKEF	0.9944	0.9708	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:38	NMSSMVVTV	0.9934	0.5126	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:16	NMSSMVVTV	0.992	0.506	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:29	NMSSMVVTV	0.992	0.6348	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:60	NMSSMVVTV	0.9918	0.5792	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:30	NMSSMVVTV	0.9917	0.6302	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:24	NMSSMVVTV	0.9917	0.6302	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:67	NMSSMVVTV	0.9917	0.6302	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:11	NMSSMVVTV	0.9914	0.6711	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:21	NMSSMVVTV	0.9914	0.7729	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:25	SMVVTVKEF	0.9912	0.9679	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:20	NMSSMVVTV	0.9905	0.6355	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B46:01	SMVVTVKEF	0.9902	0.523	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:35	NMSSMVVTV	0.9896	0.6449	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:04	NMSSMVVTV	0.9834	0.7618	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:19	NMSSMVVTV	0.9822	0.5585	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A30:08	VTVKEFLAK	0.9819	0.835	11	20
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:03	SMVVTVKEF	0.9331	0.8956	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:21	TVKEFLAKA	0.7418	0.762	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B13:02	NMSSMVVTV	0.3326	0.7196	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B13:01	SMVVTVKEF	0.0446	0.9856	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B57:03	SSMVVTVKEF	0.9973	0.988	7	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:02	NMSSMVVTV	0.998	0.6217	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:07	SMVVTVKEF	0.998	0.8921	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:05	NMSSMVVTV	0.9976	0.7718	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:21	SMVVTVKEF	0.9937	0.9605	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:07	NMSSMVVTV	0.9918	0.622	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:01	NMSSMVVTV	0.9917	0.6302	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:04	SMVVTVKEF	0.9677	0.9688	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:05	SMVVTVKEF	0.9233	0.944	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:05	TVKEFLAKA	0.912	0.5527	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:31	SMVVTVKEF	0.9019	0.9466	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:03	NMSSMVVTV	0.9986	0.7597	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:27	SMVVTVKEF	0.9983	0.9666	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:125	SMVVTVKEF	0.9982	0.9607	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:34	SMVVTVKEF	0.9982	0.9607	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:135	SMVVTVKEF	0.9982	0.9605	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:33	SMVVTVKEF	0.9982	0.9607	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:35	SMVVTVKEF	0.9976	0.9629	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:50	SMVVTVKEF	0.9972	0.9722	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:24	SMVVTVKEF	0.9972	0.9571	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:12	SMVVTVKEF	0.9923	0.9513	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:06	NMSSMVVTV	0.9914	0.7729	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:39	SMVVTVKEF	0.9901	0.9308	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A68:02	MVVTVKEFL	0.9893	0.7318	9	18
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:13	SMVVTVKEF	0.9829	0.6374	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A30:01	VTVKEFLAK	0.9824	0.9336	11	20
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A69:01	MVVTVKEFL	0.981	0.7986	9	18
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:54	SMVVTVKEF	0.9803	0.9379	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A68:02	TVKEFLAKA	0.9767	0.8469	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A69:01	NMSSMVVTV	0.9759	0.7822	5	14
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:68	SMVVTVKEF	0.9644	0.8211	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:03	TVKEFLAKA	0.9547	0.7789	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A69:01	TVKEFLAKA	0.932	0.9194	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:20	SMVVTVKEF	0.9286	0.9612	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B35:28	SMVVTVKEF	0.8948	0.963	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B35:20	SMVVTVKEF	0.8842	0.9661	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-B15:30	SMVVTVKEF	0.8272	0.8755	8	17
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:14	TVKEFLAKA	0.7458	0.6947	12	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	HLA-A02:06	TVKEFLAKA	0.7418	0.762	12	21

Top

Potential FusionNeoAntigen Information of PTBP2-PRKACB in HLA II

PTBP2-PRKACB_97217056_84644860.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1503	SSMVVTVKEFLAKAK	7	22
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1503	MSSMVVTVKEFLAKA	6	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1503	SMVVTVKEFLAKAKE	8	23
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1503	NMSSMVVTVKEFLAK	5	20
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1523	SSMVVTVKEFLAKAK	7	22
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1523	MSSMVVTVKEFLAKA	6	21
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1523	SMVVTVKEFLAKAKE	8	23
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB1-1523	NMSSMVVTVKEFLAK	5	20
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0106	MVVTVKEFLAKAKED	9	24
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0106	VVTVKEFLAKAKEDF	10	25
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0202	VVTVKEFLAKAKEDF	10	25
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0202	MVVTVKEFLAKAKED	9	24
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0204	MVVTVKEFLAKAKED	9	24
PTBP2-PRKACB	chr1	97217056	chr1	84644860	170	DRB5-0204	VVTVKEFLAKAKEDF	10	25

Top

Fusion breakpoint peptide structures of PTBP2-PRKACB

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6021	MSSMVVTVKEFLAK	PTBP2	PRKACB	chr1	97217056	chr1	84644860	170

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTBP2-PRKACB

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6021	MSSMVVTVKEFLAK	-7.9962	-8.1096
HLA-B14:02	3BVN	6021	MSSMVVTVKEFLAK	-5.70842	-6.74372
HLA-B52:01	3W39	6021	MSSMVVTVKEFLAK	-6.83737	-6.95077
HLA-B52:01	3W39	6021	MSSMVVTVKEFLAK	-4.4836	-5.5189
HLA-A11:01	4UQ2	6021	MSSMVVTVKEFLAK	-10.0067	-10.1201
HLA-A11:01	4UQ2	6021	MSSMVVTVKEFLAK	-9.03915	-10.0745
HLA-A24:02	5HGA	6021	MSSMVVTVKEFLAK	-6.56204	-6.67544
HLA-A24:02	5HGA	6021	MSSMVVTVKEFLAK	-5.42271	-6.45801
HLA-B44:05	3DX8	6021	MSSMVVTVKEFLAK	-7.85648	-8.89178
HLA-B44:05	3DX8	6021	MSSMVVTVKEFLAK	-5.3978	-5.5112
HLA-A02:01	6TDR	6021	MSSMVVTVKEFLAK	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PTBP2-PRKACB

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PTBP2-PRKACB	chr1	97217056	chr1	84644860	11	20	VTVKEFLAK	TTACAGTGAAAGAGTTTCTAGCCAAAG
PTBP2-PRKACB	chr1	97217056	chr1	84644860	12	21	TVKEFLAKA	CAGTGAAAGAGTTTCTAGCCAAAGCCA
PTBP2-PRKACB	chr1	97217056	chr1	84644860	5	14	NMSSMVVTV	ATATGAGCAGCATGGTAGTTACAGTGA
PTBP2-PRKACB	chr1	97217056	chr1	84644860	7	17	SSMVVTVKEF	GCAGCATGGTAGTTACAGTGAAAGAGTTTC
PTBP2-PRKACB	chr1	97217056	chr1	84644860	8	17	SMVVTVKEF	GCATGGTAGTTACAGTGAAAGAGTTTC
PTBP2-PRKACB	chr1	97217056	chr1	84644860	9	18	MVVTVKEFL	TGGTAGTTACAGTGAAAGAGTTTCTAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PTBP2-PRKACB	chr1	97217056	chr1	84644860	10	25	VVTVKEFLAKAKEDF	TAGTTACAGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTT
PTBP2-PRKACB	chr1	97217056	chr1	84644860	5	20	NMSSMVVTVKEFLAK	ATATGAGCAGCATGGTAGTTACAGTGAAAGAGTTTCTAGCCAAAG
PTBP2-PRKACB	chr1	97217056	chr1	84644860	6	21	MSSMVVTVKEFLAKA	TGAGCAGCATGGTAGTTACAGTGAAAGAGTTTCTAGCCAAAGCCA
PTBP2-PRKACB	chr1	97217056	chr1	84644860	7	22	SSMVVTVKEFLAKAK	GCAGCATGGTAGTTACAGTGAAAGAGTTTCTAGCCAAAGCCAAAG
PTBP2-PRKACB	chr1	97217056	chr1	84644860	8	23	SMVVTVKEFLAKAKE	GCATGGTAGTTACAGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAG
PTBP2-PRKACB	chr1	97217056	chr1	84644860	9	24	MVVTVKEFLAKAKED	TGGTAGTTACAGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACT

Top

Information of the samples that have these potential fusion neoantigens of PTBP2-PRKACB

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	PTBP2-PRKACB	chr1	97217056	ENST00000370197	chr1	84644860	ENST00000370682	ERR315409

Top

Potential target of CAR-T therapy development for PTBP2-PRKACB

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PTBP2-PRKACB

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PTBP2-PRKACB

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)