Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PTOV1-CA10

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PTOV1-CA10
	FusionPDB ID: 70136
	FusionGDB2.0 ID: 70136
		Hgene	Tgene
	Gene symbol	PTOV1	CA10
	Gene ID	53635	56934
	Gene name	PTOV1 extended AT-hook containing adaptor protein	carbonic anhydrase 10
	Synonyms	ACID2\|PTOV-1	CA-RPX\|CARPX\|HUCEP-15
	Cytomap	19q13.33	17q21.33-q22
	Type of gene	protein-coding	protein-coding
	Description	prostate tumor-overexpressed gene 1 proteinactivator interaction domain-containing protein 2prostate tumor overexpressed 1	carbonic anhydrase-related protein 10CA-RP XCARP Xcarbonic anhydrase Xcarbonic anhydrase-related protein Xcerebral protein-15epididymis secretory sperm binding protein
	Modification date	20200320	20200313
	UniProtAcc	.	Q9NS85 Main function of 5'-partner protein: FUNCTION: Does not have a catalytic activity.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000598325, ENST00000221557, ENST00000391842, ENST00000599732, ENST00000600603, ENST00000601638, ENST00000601675,	ENST00000285273, ENST00000340813, ENST00000442502, ENST00000451037, ENST00000570565, ENST00000571918,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 4=100	21 X 12 X 9=2268
	# samples	5	24
	** MAII score	log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(24/2268*10)=-3.24031432933371 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PTOV1 [Title/Abstract] AND CA10 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PTOV1 [Title/Abstract] AND CA10 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PTOV1(50361910)-CA10(49825178), # samples:2
Anticipated loss of major functional domain due to fusion event.	PTOV1-CA10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTOV1-CA10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:50361910/chr17:49825178)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PTOV1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CA10 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000600603	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	3051	1072	88	1779	563
ENST00000600603	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	3051	1072	88	1779	563
ENST00000600603	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	3043	1072	88	1779	563
ENST00000600603	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	3041	1072	88	1779	563
ENST00000600603	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2595	1072	88	1779	563
ENST00000601638	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	2977	998	14	1705	563
ENST00000601638	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	2977	998	14	1705	563
ENST00000601638	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	2969	998	14	1705	563
ENST00000601638	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	2967	998	14	1705	563
ENST00000601638	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2521	998	14	1705	563
ENST00000221557	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	2924	945	0	1652	550
ENST00000221557	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	2924	945	0	1652	550
ENST00000221557	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	2916	945	0	1652	550
ENST00000221557	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	2914	945	0	1652	550
ENST00000221557	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2468	945	0	1652	550
ENST00000391842	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	3190	1211	47	1918	623
ENST00000391842	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	3190	1211	47	1918	623
ENST00000391842	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	3182	1211	47	1918	623
ENST00000391842	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	3180	1211	47	1918	623
ENST00000391842	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2734	1211	47	1918	623
ENST00000599732	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	3158	1179	15	1886	623
ENST00000599732	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	3158	1179	15	1886	623
ENST00000599732	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	3150	1179	15	1886	623
ENST00000599732	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	3148	1179	15	1886	623
ENST00000599732	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2702	1179	15	1886	623
ENST00000601675	PTOV1	chr19	50361910	+	ENST00000570565	CA10	chr17	49825178	-	3124	1145	104	1852	582
ENST00000601675	PTOV1	chr19	50361910	+	ENST00000442502	CA10	chr17	49825178	-	3124	1145	104	1852	582
ENST00000601675	PTOV1	chr19	50361910	+	ENST00000340813	CA10	chr17	49825178	-	3116	1145	104	1852	582
ENST00000601675	PTOV1	chr19	50361910	+	ENST00000451037	CA10	chr17	49825178	-	3114	1145	104	1852	582
ENST00000601675	PTOV1	chr19	50361910	+	ENST00000285273	CA10	chr17	49825178	-	2668	1145	104	1852	582

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000600603	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016769862	0.9832302
ENST00000600603	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016769862	0.9832302
ENST00000600603	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016606862	0.98339313
ENST00000600603	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.01668397	0.983316
ENST00000600603	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.022239426	0.9777606
ENST00000601638	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016394457	0.98360556
ENST00000601638	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016394457	0.98360556
ENST00000601638	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016171882	0.98382807
ENST00000601638	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016236266	0.9837637
ENST00000601638	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.022097751	0.9779023
ENST00000221557	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016056087	0.98394394
ENST00000221557	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.016056087	0.98394394
ENST00000221557	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.015792899	0.98420715
ENST00000221557	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.015851343	0.9841487
ENST00000221557	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.021885587	0.9781145
ENST00000391842	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.02907971	0.9709203
ENST00000391842	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.02907971	0.9709203
ENST00000391842	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.028927715	0.9710723
ENST00000391842	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.02898675	0.9710133
ENST00000391842	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.035624877	0.9643751
ENST00000599732	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.029405024	0.970595
ENST00000599732	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.029405024	0.970595
ENST00000599732	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.029285055	0.9707149
ENST00000599732	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.029377071	0.97062296
ENST00000599732	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.036319163	0.9636808
ENST00000601675	ENST00000570565	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.027867306	0.9721327
ENST00000601675	ENST00000442502	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.027867306	0.9721327
ENST00000601675	ENST00000340813	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.027704282	0.97229576
ENST00000601675	ENST00000451037	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.027796442	0.97220355
ENST00000601675	ENST00000285273	PTOV1	chr19	50361910	+	CA10	chr17	49825178	-	0.034878977	0.96512103

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PTOV1-CA10

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PTOV1	chr19	50361910	CA10	chr17	49825178	1072	328	TLKSLCRIMDNGFVSGTMYNTGRHVS
PTOV1	chr19	50361910	CA10	chr17	49825178	1145	347	TLKSLCRIMDNGFVSGTMYNTGRHVS
PTOV1	chr19	50361910	CA10	chr17	49825178	1179	388	TLKSLCRIMDNGFVSGTMYNTGRHVS
PTOV1	chr19	50361910	CA10	chr17	49825178	1211	388	TLKSLCRIMDNGFVSGTMYNTGRHVS
PTOV1	chr19	50361910	CA10	chr17	49825178	945	315	TLKSLCRIMDNGFVSGTMYNTGRHVS
PTOV1	chr19	50361910	CA10	chr17	49825178	998	328	TLKSLCRIMDNGFVSGTMYNTGRHVS

Top

Potential FusionNeoAntigen Information of PTOV1-CA10 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PTOV1-CA10_50361910_49825178.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-B15:02	NGFVSGTMY	0.9362	0.944	10	19
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-B15:21	NGFVSGTMY	0.9341	0.9277	10	19
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-A02:07	IMDNGFVSGTM	0.9504	0.6929	7	18
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-B35:20	NGFVSGTMY	0.9564	0.962	10	19
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-B35:11	NGFVSGTMY	0.9306	0.9222	10	19
PTOV1-CA10	chr19	50361910	chr17	49825178	945	HLA-B35:24	NGFVSGTMY	0.8958	0.9246	10	19

Top

Potential FusionNeoAntigen Information of PTOV1-CA10 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PTOV1-CA10

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7939	RIMDNGFVSGTMYN	PTOV1	CA10	chr19	50361910	chr17	49825178	945

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTOV1-CA10

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7939	RIMDNGFVSGTMYN	-8.55667	-8.74867
HLA-B14:02	3BVN	7939	RIMDNGFVSGTMYN	-3.49457	-4.25557
HLA-B52:01	3W39	7939	RIMDNGFVSGTMYN	-7.26725	-7.45925
HLA-B52:01	3W39	7939	RIMDNGFVSGTMYN	-4.01461	-4.77561
HLA-A24:02	5HGA	7939	RIMDNGFVSGTMYN	-7.65911	-8.42011
HLA-A24:02	5HGA	7939	RIMDNGFVSGTMYN	-7.10204	-7.29404
HLA-B44:05	3DX8	7939	RIMDNGFVSGTMYN	-7.5556	-8.3166
HLA-B44:05	3DX8	7939	RIMDNGFVSGTMYN	-2.76159	-2.95359

Top

Vaccine Design for the FusionNeoAntigens of PTOV1-CA10

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PTOV1-CA10	chr19	50361910	chr17	49825178	10	19	NGFVSGTMY	AATGGCTTCGTCAGTGGGACCATGTAC
PTOV1-CA10	chr19	50361910	chr17	49825178	7	18	IMDNGFVSGTM	ATCATGGACAATGGCTTCGTCAGTGGGACCATG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PTOV1-CA10

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	PTOV1-CA10	chr19	50361910	ENST00000221557	chr17	49825178	ENST00000285273	TCGA-D7-6818-01A

Top

Potential target of CAR-T therapy development for PTOV1-CA10

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PTOV1-CA10

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PTOV1-CA10

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)