![]() |
|||||||
|
Fusion Protein:PTPN18-ARID1A |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: PTPN18-ARID1A | FusionPDB ID: 70224 | FusionGDB2.0 ID: 70224 | Hgene | Tgene | Gene symbol | PTPN18 | ARID1A | Gene ID | 26469 | 8289 |
Gene name | protein tyrosine phosphatase non-receptor type 18 | AT-rich interaction domain 1A | |
Synonyms | BDP1|PTP-HSCF | B120|BAF250|BAF250a|BM029|C1orf4|CSS2|ELD|MRD14|OSA1|P270|SMARCF1|hELD|hOSA1 | |
Cytomap | 2q21.1 | 1p36.11 | |
Type of gene | protein-coding | protein-coding | |
Description | tyrosine-protein phosphatase non-receptor type 18brain-derived phosphataseprotein tyrosine phosphatase, non-receptor type 18 (brain-derived) | AT-rich interactive domain-containing protein 1AARID domain-containing protein 1AAT rich interactive domain 1A (SWI-like)BRG1-associated factor 250aOSA1 nuclear proteinSWI-like proteinSWI/SNF complex protein p270SWI/SNF-related, matrix-associated, | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | Q99952 Main function of 5'-partner protein: FUNCTION: Differentially dephosphorylate autophosphorylated tyrosine kinases which are known to be overexpressed in tumor tissues. | O14497 Main function of 5'-partner protein: FUNCTION: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). {ECO:0000250|UniProtKB:A2BH40, ECO:0000303|PubMed:12672490, ECO:0000303|PubMed:22952240, ECO:0000303|PubMed:26601204}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000420717, ENST00000175756, ENST00000347849, | ENST00000324856, ENST00000457599, ENST00000374152, ENST00000540690, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 4 X 2=32 | 13 X 16 X 6=1248 |
# samples | 4 | 17 | |
** MAII score | log2(4/32*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(17/1248*10)=-2.87601128272455 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: PTPN18 [Title/Abstract] AND ARID1A [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: PTPN18 [Title/Abstract] AND ARID1A [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PTPN18(131117219)-ARID1A(27056142), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | PTPN18-ARID1A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPN18-ARID1A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PTPN18-ARID1A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PTPN18-ARID1A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ARID1A | GO:0006337 | nucleosome disassembly | 8895581 |
Tgene | ARID1A | GO:0006338 | chromatin remodeling | 11726552 |
Tgene | ARID1A | GO:0030520 | intracellular estrogen receptor signaling pathway | 12200431 |
Tgene | ARID1A | GO:0030521 | androgen receptor signaling pathway | 12200431 |
Tgene | ARID1A | GO:0042921 | glucocorticoid receptor signaling pathway | 12200431 |
Tgene | ARID1A | GO:0045893 | positive regulation of transcription, DNA-templated | 12200431 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:131117219/chr1:27056142) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000175756 | PTPN18 | chr2 | 131117219 | + | ENST00000324856 | ARID1A | chr1 | 27056142 | + | 7584 | 515 | 83 | 6235 | 2050 |
ENST00000175756 | PTPN18 | chr2 | 131117219 | + | ENST00000457599 | ARID1A | chr1 | 27056142 | + | 5646 | 515 | 83 | 5584 | 1833 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000175756 | ENST00000324856 | PTPN18 | chr2 | 131117219 | + | ARID1A | chr1 | 27056142 | + | 0.003965035 | 0.9960349 |
ENST00000175756 | ENST00000457599 | PTPN18 | chr2 | 131117219 | + | ARID1A | chr1 | 27056142 | + | 0.007187977 | 0.992812 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PTPN18-ARID1A |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
PTPN18 | chr2 | 131117219 | ARID1A | chr1 | 27056142 | 515 | 144 | VILMACREIENGRPSSPMDQMGKMRP |
Top |
Potential FusionNeoAntigen Information of PTPN18-ARID1A in HLA I |
![]() |
PTPN18-ARID1A_131117219_27056142.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B07:10 | RPSSPMDQM | 0.9985 | 0.5825 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B07:02 | RPSSPMDQM | 0.9984 | 0.5429 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B45:01 | IENGRPSSP | 0.9863 | 0.8073 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B45:01 | REIENGRPS | 0.9774 | 0.8992 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:02 | REIENGRPS | 0.9733 | 0.5091 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:08 | RPSSPMDQM | 0.9623 | 0.7021 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:01 | RPSSPMDQM | 0.9422 | 0.6296 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:03 | RPSSPMDQM | 0.9048 | 0.6782 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:02 | RPSSPMDQM | 0.6451 | 0.795 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:04 | RPSSPMDQM | 0.6451 | 0.795 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B41:01 | IENGRPSSP | 0.6159 | 0.9465 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:01 | IENGRPSSP | 0.4165 | 0.5774 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B41:01 | REIENGRPS | 0.3621 | 0.9122 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:01 | REIENGRPS | 0.2292 | 0.7849 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:02 | REIENGRPSS | 0.9258 | 0.596 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:01 | REIENGRPSS | 0.8163 | 0.8037 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B41:01 | REIENGRPSS | 0.816 | 0.9491 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B45:01 | REIENGRPSSP | 0.9992 | 0.9259 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B41:01 | REIENGRPSSP | 0.9985 | 0.9411 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:02 | REIENGRPSSP | 0.9982 | 0.6514 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:01 | REIENGRPSSP | 0.9968 | 0.8472 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B40:06 | REIENGRPS | 0.9948 | 0.6918 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B40:06 | IENGRPSSP | 0.994 | 0.5523 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B07:12 | RPSSPMDQM | 0.9914 | 0.6382 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:12 | RPSSPMDQM | 0.6451 | 0.795 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B39:10 | RPSSPMDQM | 0.5386 | 0.8229 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B42:02 | RPSSPMDQM | 0.3208 | 0.5447 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B42:01 | RPSSPMDQM | 0.2475 | 0.5393 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B40:06 | REIENGRPSS | 0.9794 | 0.7208 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B40:06 | REIENGRPSSP | 0.9998 | 0.8656 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B07:22 | RPSSPMDQM | 0.9984 | 0.5429 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B07:09 | RPSSPMDQM | 0.9983 | 0.5345 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:77 | RPSSPMDQM | 0.9422 | 0.6296 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:23 | RPSSPMDQM | 0.9398 | 0.6487 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:11 | RPSSPMDQM | 0.8995 | 0.686 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:13 | RPSSPMDQM | 0.8796 | 0.691 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:09 | RPSSPMDQM | 0.6451 | 0.795 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B67:01 | RPSSPMDQM | 0.5617 | 0.7153 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:05 | IENGRPSSP | 0.4165 | 0.5774 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:04 | IENGRPSSP | 0.4165 | 0.5774 | 8 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:04 | REIENGRPS | 0.2292 | 0.7849 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:05 | REIENGRPS | 0.2292 | 0.7849 | 6 | 15 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B35:43 | RPSSPMDQM | 0.0449 | 0.6512 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B15:08 | RPSSPMDQM | 0.0348 | 0.6512 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B15:11 | RPSSPMDQM | 0.0332 | 0.6573 | 12 | 21 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:05 | REIENGRPSS | 0.8163 | 0.8037 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:04 | REIENGRPSS | 0.8163 | 0.8037 | 6 | 16 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:04 | REIENGRPSSP | 0.9968 | 0.8472 | 6 | 17 |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 | HLA-B50:05 | REIENGRPSSP | 0.9968 | 0.8472 | 6 | 17 |
Top |
Potential FusionNeoAntigen Information of PTPN18-ARID1A in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of PTPN18-ARID1A |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7781 | REIENGRPSSPMDQ | PTPN18 | ARID1A | chr2 | 131117219 | chr1 | 27056142 | 515 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PTPN18-ARID1A |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7781 | REIENGRPSSPMDQ | -6.01316 | -6.12656 |
HLA-B14:02 | 3BVN | 7781 | REIENGRPSSPMDQ | -3.92858 | -4.96388 |
HLA-B52:01 | 3W39 | 7781 | REIENGRPSSPMDQ | -5.92102 | -6.95632 |
HLA-B52:01 | 3W39 | 7781 | REIENGRPSSPMDQ | -4.84472 | -4.95812 |
HLA-A24:02 | 5HGA | 7781 | REIENGRPSSPMDQ | -8.26357 | -9.29887 |
HLA-A24:02 | 5HGA | 7781 | REIENGRPSSPMDQ | -7.03366 | -7.14706 |
HLA-B44:05 | 3DX8 | 7781 | REIENGRPSSPMDQ | -6.13971 | -6.25311 |
HLA-B44:05 | 3DX8 | 7781 | REIENGRPSSPMDQ | -5.20728 | -6.24258 |
HLA-A02:01 | 6TDR | 7781 | REIENGRPSSPMDQ | -5.28864 | -5.40204 |
Top |
Vaccine Design for the FusionNeoAntigens of PTPN18-ARID1A |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 12 | 21 | RPSSPMDQM | CGGCCATCCAGTCCAATGGATCAGATG |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 6 | 15 | REIENGRPS | CGAGAGATAGAGAATGGGCGGCCATCC |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 6 | 16 | REIENGRPSS | CGAGAGATAGAGAATGGGCGGCCATCCAGT |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 6 | 17 | REIENGRPSSP | CGAGAGATAGAGAATGGGCGGCCATCCAGTCCA |
PTPN18-ARID1A | chr2 | 131117219 | chr1 | 27056142 | 8 | 17 | IENGRPSSP | ATAGAGAATGGGCGGCCATCCAGTCCA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of PTPN18-ARID1A |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
Non-Cancer | PTPN18-ARID1A | chr2 | 131117219 | ENST00000175756 | chr1 | 27056142 | ENST00000324856 | TCGA-BR-7851-11A |
Top |
Potential target of CAR-T therapy development for PTPN18-ARID1A |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to PTPN18-ARID1A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PTPN18-ARID1A |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Tgene | ARID1A | C0024623 | Malignant neoplasm of stomach | 3 | CTD_human |
Tgene | ARID1A | C0038356 | Stomach Neoplasms | 3 | CTD_human |
Tgene | ARID1A | C1708349 | Hereditary Diffuse Gastric Cancer | 3 | CTD_human |
Tgene | ARID1A | C2239176 | Liver carcinoma | 3 | CTD_human |
Tgene | ARID1A | C0033578 | Prostatic Neoplasms | 2 | CTD_human |
Tgene | ARID1A | C0376358 | Malignant neoplasm of prostate | 2 | CTD_human |
Tgene | ARID1A | C0001418 | Adenocarcinoma | 1 | CTD_human |
Tgene | ARID1A | C0005684 | Malignant neoplasm of urinary bladder | 1 | CTD_human |
Tgene | ARID1A | C0005695 | Bladder Neoplasm | 1 | CTD_human |
Tgene | ARID1A | C0006413 | Burkitt Lymphoma | 1 | CTD_human |
Tgene | ARID1A | C0007138 | Carcinoma, Transitional Cell | 1 | CTD_human |
Tgene | ARID1A | C0009402 | Colorectal Carcinoma | 1 | CTD_human |
Tgene | ARID1A | C0009404 | Colorectal Neoplasms | 1 | CTD_human |
Tgene | ARID1A | C0010606 | Adenoid Cystic Carcinoma | 1 | CTD_human |
Tgene | ARID1A | C0014170 | Endometrial Neoplasms | 1 | CTD_human |
Tgene | ARID1A | C0027708 | Nephroblastoma | 1 | CTD_human |
Tgene | ARID1A | C0027819 | Neuroblastoma | 1 | CTD_human |
Tgene | ARID1A | C0036920 | Sezary Syndrome | 1 | CTD_human |
Tgene | ARID1A | C0079772 | T-Cell Lymphoma | 1 | CTD_human |
Tgene | ARID1A | C0079773 | Lymphoma, T-Cell, Cutaneous | 1 | CTD_human |
Tgene | ARID1A | C0205641 | Adenocarcinoma, Basal Cell | 1 | CTD_human |
Tgene | ARID1A | C0205642 | Adenocarcinoma, Oxyphilic | 1 | CTD_human |
Tgene | ARID1A | C0205643 | Carcinoma, Cribriform | 1 | CTD_human |
Tgene | ARID1A | C0205644 | Carcinoma, Granular Cell | 1 | CTD_human |
Tgene | ARID1A | C0205645 | Adenocarcinoma, Tubular | 1 | CTD_human |
Tgene | ARID1A | C0206656 | Embryonal Rhabdomyosarcoma | 1 | CTD_human |
Tgene | ARID1A | C0206698 | Cholangiocarcinoma | 1 | CTD_human |
Tgene | ARID1A | C0265338 | Coffin-Siris syndrome | 1 | CTD_human;GENOMICS_ENGLAND |
Tgene | ARID1A | C0279628 | Adenocarcinoma Of Esophagus | 1 | CTD_human |
Tgene | ARID1A | C0343640 | African Burkitt's lymphoma | 1 | CTD_human |
Tgene | ARID1A | C0345905 | Intrahepatic Cholangiocarcinoma | 1 | CTD_human |
Tgene | ARID1A | C0376407 | Granulomatous Slack Skin | 1 | CTD_human |
Tgene | ARID1A | C0476089 | Endometrial Carcinoma | 1 | CTD_human |
Tgene | ARID1A | C0920269 | Microsatellite Instability | 1 | CTD_human |
Tgene | ARID1A | C1721098 | Replication Error Phenotype | 1 | CTD_human |
Tgene | ARID1A | C2930471 | Bilateral Wilms Tumor | 1 | CTD_human |
Tgene | ARID1A | C2931822 | Nasopharyngeal carcinoma | 1 | CTD_human |
Tgene | ARID1A | C3805278 | Extrahepatic Cholangiocarcinoma | 1 | CTD_human |
Tgene | ARID1A | C4721444 | Burkitt Leukemia | 1 | CTD_human |