Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PVRL3-CASK

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PVRL3-CASK
	FusionPDB ID: 70761
	FusionGDB2.0 ID: 70761
		Hgene	Tgene
	Gene symbol	PVRL3	CASK
	Gene ID	25945	8573
	Gene name	nectin cell adhesion molecule 3	calcium/calmodulin dependent serine protein kinase
	Synonyms	CD113\|CDW113\|NECTIN-3\|PPR3\|PRR3\|PVRL3\|PVRR3	CAGH39\|CAMGUK\|CMG\|FGS4\|LIN2\|MICPCH\|MRXSNA\|TNRC8\|hCASK
	Cytomap	3q13.13	Xp11.4
	Type of gene	protein-coding	protein-coding
	Description	nectin-3nectin 3poliovirus receptor-related 3poliovirus receptor-related protein 3	peripheral plasma membrane protein CASKcalcium/calmodulin-dependent serin protein kinasecalcium/calmodulin-dependent serine protein kinase (MAGUK family)calcium/calmodulin-dependent serine protein kinase membrane-associated guanylate kinaseprotein lin
	Modification date	20200313	20200327
	UniProtAcc	.	Q8WXE0 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000319792, ENST00000485303, ENST00000493615, ENST00000488016,	ENST00000378154, ENST00000472704, ENST00000318588, ENST00000361962, ENST00000378158, ENST00000378163, ENST00000378166, ENST00000421587, ENST00000442742,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 3=27	15 X 14 X 9=1890
	# samples	3	17
	** MAII score	log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(17/1890*10)=-3.47477958297073 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PVRL3 [Title/Abstract] AND CASK [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PVRL3 [Title/Abstract] AND CASK [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PVRL3(110845182)-CASK(41469278), # samples:1
Anticipated loss of major functional domain due to fusion event.	PVRL3-CASK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PVRL3-CASK seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PVRL3-CASK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PVRL3-CASK seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	CASK	GO:0010839	negative regulation of keratinocyte proliferation	18664494

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:110845182/chrX:41469278)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PVRL3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CASK (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000421587	CASK	chrX	41469278	-	8417	1252	216	2930	904
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000318588	CASK	chrX	41469278	-	8471	1252	216	2984	922
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000361962	CASK	chrX	41469278	-	8435	1252	216	2948	910
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000378163	CASK	chrX	41469278	-	4155	1252	216	2999	927
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000378158	CASK	chrX	41469278	-	3716	1252	216	2948	910
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000378166	CASK	chrX	41469278	-	3315	1252	216	2984	922
ENST00000493615	PVRL3	chr3	110845182	+	ENST00000442742	CASK	chrX	41469278	-	3000	1252	216	2915	899
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000421587	CASK	chrX	41469278	-	8509	1344	275	3022	915
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000318588	CASK	chrX	41469278	-	8563	1344	275	3076	933
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000361962	CASK	chrX	41469278	-	8527	1344	275	3040	921
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000378163	CASK	chrX	41469278	-	4247	1344	275	3091	938
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000378158	CASK	chrX	41469278	-	3808	1344	275	3040	921
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000378166	CASK	chrX	41469278	-	3407	1344	275	3076	933
ENST00000485303	PVRL3	chr3	110845182	+	ENST00000442742	CASK	chrX	41469278	-	3092	1344	275	3007	910
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000421587	CASK	chrX	41469278	-	8384	1219	150	2897	915
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000318588	CASK	chrX	41469278	-	8438	1219	150	2951	933
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000361962	CASK	chrX	41469278	-	8402	1219	150	2915	921
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000378163	CASK	chrX	41469278	-	4122	1219	150	2966	938
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000378158	CASK	chrX	41469278	-	3683	1219	150	2915	921
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000378166	CASK	chrX	41469278	-	3282	1219	150	2951	933
ENST00000319792	PVRL3	chr3	110845182	+	ENST00000442742	CASK	chrX	41469278	-	2967	1219	150	2882	910

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000493615	ENST00000421587	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000108911	0.99989104
ENST00000493615	ENST00000318588	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	9.64E-05	0.99990356
ENST00000493615	ENST00000361962	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000120728	0.99987924
ENST00000493615	ENST00000378163	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000114823	0.9998852
ENST00000493615	ENST00000378158	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000161841	0.9998381
ENST00000493615	ENST00000378166	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.00032038	0.9996797
ENST00000493615	ENST00000442742	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000657319	0.9993426
ENST00000485303	ENST00000421587	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000215687	0.9997843
ENST00000485303	ENST00000318588	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000181692	0.9998184
ENST00000485303	ENST00000361962	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000213053	0.9997869
ENST00000485303	ENST00000378163	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000164016	0.99983597
ENST00000485303	ENST00000378158	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000273575	0.99972636
ENST00000485303	ENST00000378166	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000521375	0.99947864
ENST00000485303	ENST00000442742	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000918179	0.99908185
ENST00000319792	ENST00000421587	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000215111	0.9997849
ENST00000319792	ENST00000318588	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000181626	0.9998184
ENST00000319792	ENST00000361962	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.00021283	0.99978715
ENST00000319792	ENST00000378163	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000165035	0.9998349
ENST00000319792	ENST00000378158	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000280964	0.99971896
ENST00000319792	ENST00000378166	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000533502	0.9994665
ENST00000319792	ENST00000442742	PVRL3	chr3	110845182	+	CASK	chrX	41469278	-	0.000958422	0.9990415

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PVRL3-CASK

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PVRL3	chr3	110845182	CASK	chrX	41469278	1219	356	LGQRSDQKVIYISGAVSQVLDSLEEI
PVRL3	chr3	110845182	CASK	chrX	41469278	1252	345	LGQRSDQKVIYISGAVSQVLDSLEEI
PVRL3	chr3	110845182	CASK	chrX	41469278	1344	356	LGQRSDQKVIYISGAVSQVLDSLEEI

Top

Potential FusionNeoAntigen Information of PVRL3-CASK in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PVRL3-CASK_110845182_41469278.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:21	YISGAVSQV	0.9965	0.5866	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:38	YISGAVSQV	0.9953	0.5749	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:13	YISGAVSQV	0.9948	0.6712	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:27	YISGAVSQV	0.9944	0.5041	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:04	YISGAVSQV	0.9898	0.6524	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:17	YISGAVSQV	0.9829	0.6154	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A24:14	IYISGAVSQVL	0.9885	0.5332	9	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:08	ISGAVSQVL	0.9997	0.879	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:19	ISGAVSQVL	0.9996	0.9687	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:07	ISGAVSQVL	0.9996	0.9307	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:06	ISGAVSQVL	0.9991	0.8618	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C12:04	YISGAVSQV	0.9985	0.9801	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C06:03	YISGAVSQV	0.9984	0.9842	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:06	YISGAVSQV	0.9976	0.8754	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C04:06	YISGAVSQV	0.9971	0.9611	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:07	YISGAVSQV	0.9965	0.9561	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C08:13	YISGAVSQV	0.9851	0.9684	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C08:04	YISGAVSQV	0.9851	0.9684	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C08:04	ISGAVSQVL	0.9832	0.9425	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C08:13	ISGAVSQVL	0.9832	0.9425	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C02:06	YISGAVSQV	0.852	0.966	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:04	ISGAVSQVL	0.9997	0.9663	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:03	ISGAVSQVL	0.9997	0.9663	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:05	ISGAVSQVL	0.9994	0.8785	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:17	ISGAVSQVL	0.9993	0.9411	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:05	ISGAVSQVL	0.9989	0.8875	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:02	ISGAVSQVL	0.9988	0.8296	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:02	YISGAVSQV	0.9983	0.8751	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C15:05	YISGAVSQV	0.998	0.8921	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:03	YISGAVSQV	0.9978	0.5807	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:14	YISGAVSQV	0.9965	0.5329	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A02:06	YISGAVSQV	0.9965	0.5866	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C12:03	YISGAVSQV	0.9958	0.961	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C04:03	YISGAVSQV	0.9951	0.9525	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A68:02	YISGAVSQV	0.9906	0.5468	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-A69:01	YISGAVSQV	0.9823	0.6994	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C03:06	ISGAVSQVL	0.9747	0.9669	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C12:02	YISGAVSQV	0.9729	0.9349	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C16:01	ISGAVSQVL	0.9111	0.9676	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-B35:13	ISGAVSQVL	0.8222	0.8208	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C02:10	YISGAVSQV	0.699	0.9556	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C02:02	YISGAVSQV	0.699	0.9556	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C17:01	YISGAVSQV	0.6485	0.9641	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-B07:13	YISGAVSQV	0.4136	0.8397	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C07:04	YISGAVSQV	0.2161	0.9596	10	19
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-B07:13	ISGAVSQVL	0.115	0.806	11	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C14:03	IYISGAVSQVL	0.979	0.9416	9	20
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	HLA-C14:02	IYISGAVSQVL	0.979	0.9416	9	20

Top

Potential FusionNeoAntigen Information of PVRL3-CASK in HLA II

PVRL3-CASK_110845182_41469278.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PVRL3-CASK	chr3	110845182	chrX	41469278	1219	DRB1-1002	SDQKVIYISGAVSQV	4	19

Top

Fusion breakpoint peptide structures of PVRL3-CASK

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7368	QKVIYISGAVSQVL	PVRL3	CASK	chr3	110845182	chrX	41469278	1219

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PVRL3-CASK

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7368	QKVIYISGAVSQVL	-7.15543	-7.26883
HLA-B14:02	3BVN	7368	QKVIYISGAVSQVL	-4.77435	-5.80965
HLA-B52:01	3W39	7368	QKVIYISGAVSQVL	-6.80875	-6.92215
HLA-B52:01	3W39	7368	QKVIYISGAVSQVL	-4.20386	-5.23916
HLA-A11:01	4UQ2	7368	QKVIYISGAVSQVL	-7.5194	-8.5547
HLA-A11:01	4UQ2	7368	QKVIYISGAVSQVL	-6.9601	-7.0735
HLA-A24:02	5HGA	7368	QKVIYISGAVSQVL	-7.52403	-7.63743
HLA-A24:02	5HGA	7368	QKVIYISGAVSQVL	-5.82433	-6.85963
HLA-B27:05	6PYJ	7368	QKVIYISGAVSQVL	-3.28285	-4.31815
HLA-B44:05	3DX8	7368	QKVIYISGAVSQVL	-5.91172	-6.94702
HLA-B44:05	3DX8	7368	QKVIYISGAVSQVL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of PVRL3-CASK

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PVRL3-CASK	chr3	110845182	chrX	41469278	10	19	YISGAVSQV	ACATTTCAGGAGCAGTCTCACAGGTGC
PVRL3-CASK	chr3	110845182	chrX	41469278	11	20	ISGAVSQVL	TTTCAGGAGCAGTCTCACAGGTGCTGG
PVRL3-CASK	chr3	110845182	chrX	41469278	9	20	IYISGAVSQVL	TCTACATTTCAGGAGCAGTCTCACAGGTGCTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
PVRL3-CASK	chr3	110845182	chrX	41469278	4	19	SDQKVIYISGAVSQV	GTGACCAAAAAGTCATCTACATTTCAGGAGCAGTCTCACAGGTGC

Top

Information of the samples that have these potential fusion neoantigens of PVRL3-CASK

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LGG	PVRL3-CASK	chr3	110845182	ENST00000319792	chrX	41469278	ENST00000318588	TCGA-HT-7686

Top

Potential target of CAR-T therapy development for PVRL3-CASK

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PVRL3-CASK

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PVRL3-CASK

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)