![]() |
|||||||
|
Fusion Protein:ASH2L-ILF3 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ASH2L-ILF3 | FusionPDB ID: 7130 | FusionGDB2.0 ID: 7130 | Hgene | Tgene | Gene symbol | ASH2L | ILF3 | Gene ID | 9070 | 3609 |
Gene name | ASH2 like, histone lysine methyltransferase complex subunit | interleukin enhancer binding factor 3 | |
Synonyms | ASH2|ASH2L1|ASH2L2|Bre2 | CBTF|DRBF|DRBP76|MMP4|MPHOSPH4|MPP4|MPP4110|NF-AT-90|NF110|NF110b|NF90|NF90a|NF90b|NF90c|NF90ctv|NFAR|NFAR-1|NFAR-2|NFAR110|NFAR2|NFAR90|TCP110|TCP80 | |
Cytomap | 8p11.23 | 19p13.2 | |
Type of gene | protein-coding | protein-coding | |
Description | set1/Ash2 histone methyltransferase complex subunit ASH2ASH2-like proteinash2 (absent, small, or homeotic)-like | interleukin enhancer-binding factor 3M phase phosphoprotein 4, nuclear factor associated with DS RNAM-phase phosphoprotein 4double-stranded RNA-binding protein, 76 kDdsRNA binding protein NFAR-2/MPP4interleukin enhancer binding factor 3, 90kDinterle | |
Modification date | 20200313 | 20200322 | |
UniProtAcc | Q9UBL3 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator (PubMed:12670868). Component or associated component of some histone methyltransferase complexes which regulates transcription through recruitment of those complexes to gene promoters (PubMed:19131338). Component of the Set1/Ash2 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3, but not if the neighboring 'Lys-9' residue is already methylated (PubMed:19556245). As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3 (PubMed:19556245). May play a role in hematopoiesis (PubMed:12670868). In association with RBBP5 and WDR5, stimulates the histone methyltransferase activities of KMT2A, KMT2B, KMT2C, KMT2D, SETD1A and SETD1B (PubMed:21220120, PubMed:22266653). {ECO:0000269|PubMed:12670868, ECO:0000269|PubMed:19131338, ECO:0000269|PubMed:19556245, ECO:0000269|PubMed:21220120, ECO:0000269|PubMed:22266653}. | Q12906 Main function of 5'-partner protein: FUNCTION: RNA-binding protein that plays an essential role in the biogenesis of circular RNAs (circRNAs) which are produced by back-splicing circularization of pre-mRNAs. Within the nucleus, promotes circRNAs processing by stabilizing the regulatory elements residing in the flanking introns of the circularized exons. Plays thereby a role in the back-splicing of a subset of circRNAs (PubMed:28625552). As a consequence, participates in a wide range of transcriptional and post-transcriptional processes. Binds to poly-U elements and AU-rich elements (AREs) in the 3'-UTR of target mRNAs (PubMed:14731398). Upon viral infection, ILF3 accumulates in the cytoplasm and participates in the innate antiviral response (PubMed:21123651). Mechanistically, ILF3 becomes phosphorylated and activated by the double-stranded RNA-activated protein kinase/PKR which releases ILF3 from cellular mature circRNAs. In turn, unbound ILF3 molecules are able to interact with and thus inhibit viral mRNAs (PubMed:21123651, PubMed:28625552). {ECO:0000269|PubMed:14731398, ECO:0000269|PubMed:21123651, ECO:0000269|PubMed:28625552, ECO:0000269|PubMed:9442054}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000343823, ENST00000428278, ENST00000545394, ENST00000250635, ENST00000521652, ENST00000524263, | ENST00000586544, ENST00000250241, ENST00000318511, ENST00000407004, ENST00000420083, ENST00000449870, ENST00000588657, ENST00000589998, ENST00000590261, ENST00000592763, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 10 X 6=780 | 17 X 23 X 6=2346 |
# samples | 14 | 25 | |
** MAII score | log2(14/780*10)=-2.47804729680464 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(25/2346*10)=-3.23020301336642 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ASH2L [Title/Abstract] AND ILF3 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ASH2L [Title/Abstract] AND ILF3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ASH2L(37993284)-ILF3(10787838), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ASH2L | GO:0006974 | cellular response to DNA damage stimulus | 17500065 |
Hgene | ASH2L | GO:0043627 | response to estrogen | 16603732 |
Hgene | ASH2L | GO:0051568 | histone H3-K4 methylation | 17355966|19556245 |
Tgene | ILF3 | GO:0006468 | protein phosphorylation | 21123651 |
Tgene | ILF3 | GO:0045892 | negative regulation of transcription, DNA-templated | 11739746 |
Tgene | ILF3 | GO:0045893 | positive regulation of transcription, DNA-templated | 11739746 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:37993284/chr19:10787838) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000420083 | ILF3 | chr19 | 10787838 | + | 4585 | 2028 | 309 | 3689 | 1126 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000449870 | ILF3 | chr19 | 10787838 | + | 7419 | 2028 | 309 | 4313 | 1334 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000318511 | ILF3 | chr19 | 10787838 | + | 7407 | 2028 | 309 | 4301 | 1330 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000407004 | ILF3 | chr19 | 10787838 | + | 5038 | 2028 | 309 | 3737 | 1142 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000589998 | ILF3 | chr19 | 10787838 | + | 4022 | 2028 | 309 | 3725 | 1138 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000250241 | ILF3 | chr19 | 10787838 | + | 4583 | 2028 | 309 | 3689 | 1126 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000592763 | ILF3 | chr19 | 10787838 | + | 5483 | 2028 | 309 | 3713 | 1134 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000588657 | ILF3 | chr19 | 10787838 | + | 4314 | 2028 | 309 | 4313 | 1334 |
ENST00000343823 | ASH2L | chr8 | 37993284 | + | ENST00000590261 | ILF3 | chr19 | 10787838 | + | 4836 | 2028 | 309 | 4301 | 1330 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000420083 | ILF3 | chr19 | 10787838 | + | 4131 | 1574 | 272 | 3235 | 987 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000449870 | ILF3 | chr19 | 10787838 | + | 6965 | 1574 | 272 | 3859 | 1195 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000318511 | ILF3 | chr19 | 10787838 | + | 6953 | 1574 | 272 | 3847 | 1191 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000407004 | ILF3 | chr19 | 10787838 | + | 4584 | 1574 | 272 | 3283 | 1003 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000589998 | ILF3 | chr19 | 10787838 | + | 3568 | 1574 | 272 | 3271 | 999 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000250241 | ILF3 | chr19 | 10787838 | + | 4129 | 1574 | 272 | 3235 | 987 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000592763 | ILF3 | chr19 | 10787838 | + | 5029 | 1574 | 272 | 3259 | 995 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000588657 | ILF3 | chr19 | 10787838 | + | 3860 | 1574 | 272 | 3859 | 1196 |
ENST00000545394 | ASH2L | chr8 | 37993284 | + | ENST00000590261 | ILF3 | chr19 | 10787838 | + | 4382 | 1574 | 272 | 3847 | 1191 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000420083 | ILF3 | chr19 | 10787838 | + | 4435 | 1878 | 357 | 3539 | 1060 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000449870 | ILF3 | chr19 | 10787838 | + | 7269 | 1878 | 357 | 4163 | 1268 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000318511 | ILF3 | chr19 | 10787838 | + | 7257 | 1878 | 357 | 4151 | 1264 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000407004 | ILF3 | chr19 | 10787838 | + | 4888 | 1878 | 357 | 3587 | 1076 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000589998 | ILF3 | chr19 | 10787838 | + | 3872 | 1878 | 357 | 3575 | 1072 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000250241 | ILF3 | chr19 | 10787838 | + | 4433 | 1878 | 357 | 3539 | 1060 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000592763 | ILF3 | chr19 | 10787838 | + | 5333 | 1878 | 357 | 3563 | 1068 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000588657 | ILF3 | chr19 | 10787838 | + | 4164 | 1878 | 357 | 4163 | 1268 |
ENST00000428278 | ASH2L | chr8 | 37993284 | + | ENST00000590261 | ILF3 | chr19 | 10787838 | + | 4686 | 1878 | 357 | 4151 | 1264 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000343823 | ENST00000420083 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.00091164 | 0.9990884 |
ENST00000343823 | ENST00000449870 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.001370759 | 0.9986292 |
ENST00000343823 | ENST00000318511 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000818511 | 0.99918145 |
ENST00000343823 | ENST00000407004 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000588611 | 0.99941134 |
ENST00000343823 | ENST00000589998 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.001136359 | 0.9988637 |
ENST00000343823 | ENST00000250241 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000902662 | 0.99909735 |
ENST00000343823 | ENST00000592763 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000618163 | 0.9993818 |
ENST00000343823 | ENST00000588657 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.002485028 | 0.99751496 |
ENST00000343823 | ENST00000590261 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000909742 | 0.9990903 |
ENST00000545394 | ENST00000420083 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.00050829 | 0.9994917 |
ENST00000545394 | ENST00000449870 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.001296808 | 0.9987031 |
ENST00000545394 | ENST00000318511 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000761851 | 0.99923813 |
ENST00000545394 | ENST00000407004 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000511955 | 0.999488 |
ENST00000545394 | ENST00000589998 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000780648 | 0.9992193 |
ENST00000545394 | ENST00000250241 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000502013 | 0.999498 |
ENST00000545394 | ENST00000592763 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000321427 | 0.9996786 |
ENST00000545394 | ENST00000588657 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.002460358 | 0.99753964 |
ENST00000545394 | ENST00000590261 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000843516 | 0.9991565 |
ENST00000428278 | ENST00000420083 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000950383 | 0.9990496 |
ENST00000428278 | ENST00000449870 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.001483107 | 0.99851686 |
ENST00000428278 | ENST00000318511 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000870713 | 0.99912935 |
ENST00000428278 | ENST00000407004 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000605484 | 0.99939454 |
ENST00000428278 | ENST00000589998 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.001203456 | 0.9987966 |
ENST00000428278 | ENST00000250241 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000939948 | 0.9990601 |
ENST00000428278 | ENST00000592763 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000653942 | 0.9993461 |
ENST00000428278 | ENST00000588657 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.002617919 | 0.9973821 |
ENST00000428278 | ENST00000590261 | ASH2L | chr8 | 37993284 | + | ILF3 | chr19 | 10787838 | + | 0.000963498 | 0.99903655 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ASH2L-ILF3 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ASH2L | chr8 | 37993284 | ILF3 | chr19 | 10787838 | 1574 | 434 | VYFPAISLYKSCTAVTEDKYEILQSV |
ASH2L | chr8 | 37993284 | ILF3 | chr19 | 10787838 | 1878 | 507 | VYFPAISLYKSCTAVTEDKYEILQSV |
ASH2L | chr8 | 37993284 | ILF3 | chr19 | 10787838 | 2028 | 573 | VYFPAISLYKSCTAVTEDKYEILQSV |
Top |
Potential FusionNeoAntigen Information of ASH2L-ILF3 in HLA I |
![]() |
ASH2L-ILF3_37993284_10787838.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-A02:13 | SLYKSCTAV | 0.9907 | 0.5243 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-A02:38 | SLYKSCTAV | 0.9807 | 0.5157 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-A02:21 | SLYKSCTAV | 0.9642 | 0.5906 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-B13:02 | SLYKSCTAV | 0.0191 | 0.5459 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-B15:04 | SLYKSCTAV | 0.7877 | 0.8142 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-A02:03 | SLYKSCTAV | 0.9972 | 0.5243 | 6 | 15 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | HLA-A02:06 | SLYKSCTAV | 0.9642 | 0.5906 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of ASH2L-ILF3 in HLA II |
![]() |
ASH2L-ILF3_37993284_10787838.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1501 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1506 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1509 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1513 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1516 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1520 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1522 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1524 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1528 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1532 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1533 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1537 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1540 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1541 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1542 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1543 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1545 | FPAISLYKSCTAVTE | 2 | 17 |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 | DRB1-1546 | FPAISLYKSCTAVTE | 2 | 17 |
Top |
Fusion breakpoint peptide structures of ASH2L-ILF3 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8814 | SLYKSCTAVTEDKY | ASH2L | ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2028 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ASH2L-ILF3 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8814 | SLYKSCTAVTEDKY | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 8814 | SLYKSCTAVTEDKY | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 8814 | SLYKSCTAVTEDKY | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 8814 | SLYKSCTAVTEDKY | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 8814 | SLYKSCTAVTEDKY | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 8814 | SLYKSCTAVTEDKY | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 8814 | SLYKSCTAVTEDKY | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 8814 | SLYKSCTAVTEDKY | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 8814 | SLYKSCTAVTEDKY | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 8814 | SLYKSCTAVTEDKY | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 8814 | SLYKSCTAVTEDKY | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ASH2L-ILF3 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 6 | 15 | SLYKSCTAV | TCACTGTACAAGAGCTGCACGGCTGTA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ASH2L-ILF3 | chr8 | 37993284 | chr19 | 10787838 | 2 | 17 | FPAISLYKSCTAVTE | TTCCCAGCCATCTCACTGTACAAGAGCTGCACGGCTGTAACAGAA |
Top |
Information of the samples that have these potential fusion neoantigens of ASH2L-ILF3 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | ASH2L-ILF3 | chr8 | 37993284 | ENST00000343823 | chr19 | 10787838 | ENST00000250241 | TCGA-D8-A1XD |
Top |
Potential target of CAR-T therapy development for ASH2L-ILF3 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ASH2L-ILF3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ASH2L-ILF3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |