Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ASH2L-ILF3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ASH2L-ILF3
	FusionPDB ID: 7130
	FusionGDB2.0 ID: 7130
		Hgene	Tgene
	Gene symbol	ASH2L	ILF3
	Gene ID	9070	3609
	Gene name	ASH2 like, histone lysine methyltransferase complex subunit	interleukin enhancer binding factor 3
	Synonyms	ASH2\|ASH2L1\|ASH2L2\|Bre2	CBTF\|DRBF\|DRBP76\|MMP4\|MPHOSPH4\|MPP4\|MPP4110\|NF-AT-90\|NF110\|NF110b\|NF90\|NF90a\|NF90b\|NF90c\|NF90ctv\|NFAR\|NFAR-1\|NFAR-2\|NFAR110\|NFAR2\|NFAR90\|TCP110\|TCP80
	Cytomap	8p11.23	19p13.2
	Type of gene	protein-coding	protein-coding
	Description	set1/Ash2 histone methyltransferase complex subunit ASH2ASH2-like proteinash2 (absent, small, or homeotic)-like	interleukin enhancer-binding factor 3M phase phosphoprotein 4, nuclear factor associated with DS RNAM-phase phosphoprotein 4double-stranded RNA-binding protein, 76 kDdsRNA binding protein NFAR-2/MPP4interleukin enhancer binding factor 3, 90kDinterle
	Modification date	20200313	20200322
	UniProtAcc	Q9UBL3 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator (PubMed:12670868). Component or associated component of some histone methyltransferase complexes which regulates transcription through recruitment of those complexes to gene promoters (PubMed:19131338). Component of the Set1/Ash2 histone methyltransferase (HMT) complex, a complex that specifically methylates 'Lys-4' of histone H3, but not if the neighboring 'Lys-9' residue is already methylated (PubMed:19556245). As part of the MLL1/MLL complex it is involved in methylation and dimethylation at 'Lys-4' of histone H3 (PubMed:19556245). May play a role in hematopoiesis (PubMed:12670868). In association with RBBP5 and WDR5, stimulates the histone methyltransferase activities of KMT2A, KMT2B, KMT2C, KMT2D, SETD1A and SETD1B (PubMed:21220120, PubMed:22266653). {ECO:0000269\|PubMed:12670868, ECO:0000269\|PubMed:19131338, ECO:0000269\|PubMed:19556245, ECO:0000269\|PubMed:21220120, ECO:0000269\|PubMed:22266653}.	Q12906 Main function of 5'-partner protein: FUNCTION: RNA-binding protein that plays an essential role in the biogenesis of circular RNAs (circRNAs) which are produced by back-splicing circularization of pre-mRNAs. Within the nucleus, promotes circRNAs processing by stabilizing the regulatory elements residing in the flanking introns of the circularized exons. Plays thereby a role in the back-splicing of a subset of circRNAs (PubMed:28625552). As a consequence, participates in a wide range of transcriptional and post-transcriptional processes. Binds to poly-U elements and AU-rich elements (AREs) in the 3'-UTR of target mRNAs (PubMed:14731398). Upon viral infection, ILF3 accumulates in the cytoplasm and participates in the innate antiviral response (PubMed:21123651). Mechanistically, ILF3 becomes phosphorylated and activated by the double-stranded RNA-activated protein kinase/PKR which releases ILF3 from cellular mature circRNAs. In turn, unbound ILF3 molecules are able to interact with and thus inhibit viral mRNAs (PubMed:21123651, PubMed:28625552). {ECO:0000269\|PubMed:14731398, ECO:0000269\|PubMed:21123651, ECO:0000269\|PubMed:28625552, ECO:0000269\|PubMed:9442054}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000343823, ENST00000428278, ENST00000545394, ENST00000250635, ENST00000521652, ENST00000524263,	ENST00000586544, ENST00000250241, ENST00000318511, ENST00000407004, ENST00000420083, ENST00000449870, ENST00000588657, ENST00000589998, ENST00000590261, ENST00000592763,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 6=780	17 X 23 X 6=2346
	# samples	14	25
	** MAII score	log2(14/780*10)=-2.47804729680464 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(25/2346*10)=-3.23020301336642 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ASH2L [Title/Abstract] AND ILF3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ASH2L [Title/Abstract] AND ILF3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ASH2L(37993284)-ILF3(10787838), # samples:1
Anticipated loss of major functional domain due to fusion event.	ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ASH2L-ILF3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ASH2L	GO:0006974	cellular response to DNA damage stimulus	17500065
Hgene	ASH2L	GO:0043627	response to estrogen	16603732
Hgene	ASH2L	GO:0051568	histone H3-K4 methylation	17355966\|19556245
Tgene	ILF3	GO:0006468	protein phosphorylation	21123651
Tgene	ILF3	GO:0045892	negative regulation of transcription, DNA-templated	11739746
Tgene	ILF3	GO:0045893	positive regulation of transcription, DNA-templated	11739746

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:37993284/chr19:10787838)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ASH2L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ILF3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000420083	ILF3	chr19	10787838	+	4585	2028	309	3689	1126
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000449870	ILF3	chr19	10787838	+	7419	2028	309	4313	1334
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000318511	ILF3	chr19	10787838	+	7407	2028	309	4301	1330
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000407004	ILF3	chr19	10787838	+	5038	2028	309	3737	1142
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000589998	ILF3	chr19	10787838	+	4022	2028	309	3725	1138
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000250241	ILF3	chr19	10787838	+	4583	2028	309	3689	1126
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000592763	ILF3	chr19	10787838	+	5483	2028	309	3713	1134
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000588657	ILF3	chr19	10787838	+	4314	2028	309	4313	1334
ENST00000343823	ASH2L	chr8	37993284	+	ENST00000590261	ILF3	chr19	10787838	+	4836	2028	309	4301	1330
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000420083	ILF3	chr19	10787838	+	4131	1574	272	3235	987
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000449870	ILF3	chr19	10787838	+	6965	1574	272	3859	1195
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000318511	ILF3	chr19	10787838	+	6953	1574	272	3847	1191
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000407004	ILF3	chr19	10787838	+	4584	1574	272	3283	1003
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000589998	ILF3	chr19	10787838	+	3568	1574	272	3271	999
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000250241	ILF3	chr19	10787838	+	4129	1574	272	3235	987
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000592763	ILF3	chr19	10787838	+	5029	1574	272	3259	995
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000588657	ILF3	chr19	10787838	+	3860	1574	272	3859	1196
ENST00000545394	ASH2L	chr8	37993284	+	ENST00000590261	ILF3	chr19	10787838	+	4382	1574	272	3847	1191
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000420083	ILF3	chr19	10787838	+	4435	1878	357	3539	1060
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000449870	ILF3	chr19	10787838	+	7269	1878	357	4163	1268
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000318511	ILF3	chr19	10787838	+	7257	1878	357	4151	1264
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000407004	ILF3	chr19	10787838	+	4888	1878	357	3587	1076
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000589998	ILF3	chr19	10787838	+	3872	1878	357	3575	1072
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000250241	ILF3	chr19	10787838	+	4433	1878	357	3539	1060
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000592763	ILF3	chr19	10787838	+	5333	1878	357	3563	1068
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000588657	ILF3	chr19	10787838	+	4164	1878	357	4163	1268
ENST00000428278	ASH2L	chr8	37993284	+	ENST00000590261	ILF3	chr19	10787838	+	4686	1878	357	4151	1264

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000343823	ENST00000420083	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.00091164	0.9990884
ENST00000343823	ENST00000449870	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.001370759	0.9986292
ENST00000343823	ENST00000318511	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000818511	0.99918145
ENST00000343823	ENST00000407004	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000588611	0.99941134
ENST00000343823	ENST00000589998	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.001136359	0.9988637
ENST00000343823	ENST00000250241	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000902662	0.99909735
ENST00000343823	ENST00000592763	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000618163	0.9993818
ENST00000343823	ENST00000588657	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.002485028	0.99751496
ENST00000343823	ENST00000590261	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000909742	0.9990903
ENST00000545394	ENST00000420083	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.00050829	0.9994917
ENST00000545394	ENST00000449870	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.001296808	0.9987031
ENST00000545394	ENST00000318511	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000761851	0.99923813
ENST00000545394	ENST00000407004	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000511955	0.999488
ENST00000545394	ENST00000589998	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000780648	0.9992193
ENST00000545394	ENST00000250241	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000502013	0.999498
ENST00000545394	ENST00000592763	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000321427	0.9996786
ENST00000545394	ENST00000588657	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.002460358	0.99753964
ENST00000545394	ENST00000590261	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000843516	0.9991565
ENST00000428278	ENST00000420083	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000950383	0.9990496
ENST00000428278	ENST00000449870	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.001483107	0.99851686
ENST00000428278	ENST00000318511	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000870713	0.99912935
ENST00000428278	ENST00000407004	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000605484	0.99939454
ENST00000428278	ENST00000589998	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.001203456	0.9987966
ENST00000428278	ENST00000250241	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000939948	0.9990601
ENST00000428278	ENST00000592763	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000653942	0.9993461
ENST00000428278	ENST00000588657	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.002617919	0.9973821
ENST00000428278	ENST00000590261	ASH2L	chr8	37993284	+	ILF3	chr19	10787838	+	0.000963498	0.99903655

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ASH2L-ILF3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ASH2L	chr8	37993284	ILF3	chr19	10787838	1574	434	VYFPAISLYKSCTAVTEDKYEILQSV
ASH2L	chr8	37993284	ILF3	chr19	10787838	1878	507	VYFPAISLYKSCTAVTEDKYEILQSV
ASH2L	chr8	37993284	ILF3	chr19	10787838	2028	573	VYFPAISLYKSCTAVTEDKYEILQSV

Top

Potential FusionNeoAntigen Information of ASH2L-ILF3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ASH2L-ILF3_37993284_10787838.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-A02:13	SLYKSCTAV	0.9907	0.5243	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-A02:38	SLYKSCTAV	0.9807	0.5157	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-A02:21	SLYKSCTAV	0.9642	0.5906	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-B13:02	SLYKSCTAV	0.0191	0.5459	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-B15:04	SLYKSCTAV	0.7877	0.8142	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-A02:03	SLYKSCTAV	0.9972	0.5243	6	15
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	HLA-A02:06	SLYKSCTAV	0.9642	0.5906	6	15

Top

Potential FusionNeoAntigen Information of ASH2L-ILF3 in HLA II

ASH2L-ILF3_37993284_10787838.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1501	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1506	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1509	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1513	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1516	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1520	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1522	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1524	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1528	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1532	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1533	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1537	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1540	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1541	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1542	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1543	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1545	FPAISLYKSCTAVTE	2	17
ASH2L-ILF3	chr8	37993284	chr19	10787838	2028	DRB1-1546	FPAISLYKSCTAVTE	2	17

Top

Fusion breakpoint peptide structures of ASH2L-ILF3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8814	SLYKSCTAVTEDKY	ASH2L	ILF3	chr8	37993284	chr19	10787838	2028

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ASH2L-ILF3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8814	SLYKSCTAVTEDKY	-7.9962	-8.1096
HLA-B14:02	3BVN	8814	SLYKSCTAVTEDKY	-5.70842	-6.74372
HLA-B52:01	3W39	8814	SLYKSCTAVTEDKY	-6.83737	-6.95077
HLA-B52:01	3W39	8814	SLYKSCTAVTEDKY	-4.4836	-5.5189
HLA-A11:01	4UQ2	8814	SLYKSCTAVTEDKY	-10.0067	-10.1201
HLA-A11:01	4UQ2	8814	SLYKSCTAVTEDKY	-9.03915	-10.0745
HLA-A24:02	5HGA	8814	SLYKSCTAVTEDKY	-6.56204	-6.67544
HLA-A24:02	5HGA	8814	SLYKSCTAVTEDKY	-5.42271	-6.45801
HLA-B44:05	3DX8	8814	SLYKSCTAVTEDKY	-7.85648	-8.89178
HLA-B44:05	3DX8	8814	SLYKSCTAVTEDKY	-5.3978	-5.5112
HLA-A02:01	6TDR	8814	SLYKSCTAVTEDKY	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ASH2L-ILF3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ASH2L-ILF3	chr8	37993284	chr19	10787838	6	15	SLYKSCTAV	TCACTGTACAAGAGCTGCACGGCTGTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ASH2L-ILF3	chr8	37993284	chr19	10787838	2	17	FPAISLYKSCTAVTE	TTCCCAGCCATCTCACTGTACAAGAGCTGCACGGCTGTAACAGAA

Top

Information of the samples that have these potential fusion neoantigens of ASH2L-ILF3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	ASH2L-ILF3	chr8	37993284	ENST00000343823	chr19	10787838	ENST00000250241	TCGA-D8-A1XD

Top

Potential target of CAR-T therapy development for ASH2L-ILF3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ASH2L-ILF3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ASH2L-ILF3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)