Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RAB3GAP1-MAP4K3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RAB3GAP1-MAP4K3
	FusionPDB ID: 71358
	FusionGDB2.0 ID: 71358
		Hgene	Tgene
	Gene symbol	RAB3GAP1	MAP4K3
	Gene ID	22930	8491
	Gene name	RAB3 GTPase activating protein catalytic subunit 1	mitogen-activated protein kinase kinase kinase kinase 3
	Synonyms	P130\|RAB3GAP\|RAB3GAP130\|WARBM1	GLK\|MAPKKKK3\|MEKKK 3\|MEKKK3\|RAB8IPL1
	Cytomap	2q21.3	2p22.1
	Type of gene	protein-coding	protein-coding
	Description	rab3 GTPase-activating protein catalytic subunitRAB3 GTPase activating protein subunit 1 (catalytic)RAB3 GTPase-activating protein 130 kDa subunitrab3-GAP p130	mitogen-activated protein kinase kinase kinase kinase 3MAPK/ERK kinase kinase kinase 3MEK kinase kinase 3germinal center kinase-like kinasegerminal center kinase-related protein kinase
	Modification date	20200313	20200313
	UniProtAcc	.	Q8IVH8 Main function of 5'-partner protein: FUNCTION: May play a role in the response to environmental stress. Appears to act upstream of the JUN N-terminal pathway. {ECO:0000269\|PubMed:9275185}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000487003, ENST00000264158, ENST00000442034, ENST00000539493, ENST00000425393,	ENST00000263881, ENST00000341681, ENST00000437545, ENST00000474502, ENST00000484274, ENST00000536018,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 11 X 9=1287	8 X 8 X 7=448
	# samples	17	11
	** MAII score	log2(17/1287*10)=-2.920405402083 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/448*10)=-2.02599520853294 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: RAB3GAP1 [Title/Abstract] AND MAP4K3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RAB3GAP1 [Title/Abstract] AND MAP4K3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RAB3GAP1(135911446)-MAP4K3(39499683), # samples:3
Anticipated loss of major functional domain due to fusion event.	RAB3GAP1-MAP4K3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RAB3GAP1-MAP4K3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RAB3GAP1	GO:0043087	regulation of GTPase activity	10859313
Tgene	MAP4K3	GO:0006468	protein phosphorylation	9275185
Tgene	MAP4K3	GO:0009411	response to UV	9275185
Tgene	MAP4K3	GO:0034612	response to tumor necrosis factor	9275185
Tgene	MAP4K3	GO:0035556	intracellular signal transduction	9275185

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:135911446/chr2:39499683)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RAB3GAP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MAP4K3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000264158	RAB3GAP1	chr2	135911446	+	ENST00000263881	MAP4K3	chr2	39499683	-	4575	2332	43	3222	1059
ENST00000264158	RAB3GAP1	chr2	135911446	+	ENST00000437545	MAP4K3	chr2	39499683	-	4563	2332	43	3222	1059
ENST00000264158	RAB3GAP1	chr2	135911446	+	ENST00000341681	MAP4K3	chr2	39499683	-	4558	2332	43	3222	1059
ENST00000539493	RAB3GAP1	chr2	135911446	+	ENST00000263881	MAP4K3	chr2	39499683	-	4812	2569	412	3459	1015
ENST00000539493	RAB3GAP1	chr2	135911446	+	ENST00000437545	MAP4K3	chr2	39499683	-	4800	2569	412	3459	1015
ENST00000539493	RAB3GAP1	chr2	135911446	+	ENST00000341681	MAP4K3	chr2	39499683	-	4795	2569	412	3459	1015
ENST00000442034	RAB3GAP1	chr2	135911446	+	ENST00000263881	MAP4K3	chr2	39499683	-	4542	2299	10	3189	1059
ENST00000442034	RAB3GAP1	chr2	135911446	+	ENST00000437545	MAP4K3	chr2	39499683	-	4530	2299	10	3189	1059
ENST00000442034	RAB3GAP1	chr2	135911446	+	ENST00000341681	MAP4K3	chr2	39499683	-	4525	2299	10	3189	1059

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000264158	ENST00000263881	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	9.23E-05	0.99990773
ENST00000264158	ENST00000437545	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	9.38E-05	0.9999062
ENST00000264158	ENST00000341681	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	9.27E-05	0.99990726
ENST00000539493	ENST00000263881	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	0.000140207	0.9998598
ENST00000539493	ENST00000437545	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	0.000142541	0.9998574
ENST00000539493	ENST00000341681	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	0.000140606	0.99985933
ENST00000442034	ENST00000263881	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	8.75E-05	0.9999125
ENST00000442034	ENST00000437545	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	8.89E-05	0.99991107
ENST00000442034	ENST00000341681	RAB3GAP1	chr2	135911446	+	MAP4K3	chr2	39499683	-	8.79E-05	0.99991214

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RAB3GAP1-MAP4K3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RAB3GAP1	chr2	135911446	MAP4K3	chr2	39499683	2299	763	QRRLFDDTREAEKLFPRRCTWLYVMN
RAB3GAP1	chr2	135911446	MAP4K3	chr2	39499683	2332	763	QRRLFDDTREAEKLFPRRCTWLYVMN
RAB3GAP1	chr2	135911446	MAP4K3	chr2	39499683	2569	719	QRRLFDDTREAEKLFPRRCTWLYVMN

Top

Potential FusionNeoAntigen Information of RAB3GAP1-MAP4K3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RAB3GAP1-MAP4K3_135911446_39499683.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B57:01	KLFPRRCTW	0.9967	0.9971	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A31:08	KLFPRRCTW	0.9954	0.8129	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A32:13	KLFPRRCTW	0.9874	0.9951	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B58:01	KLFPRRCTW	0.9874	0.9944	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B58:02	KLFPRRCTW	0.9803	0.9914	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B45:01	AEKLFPRRC	0.9555	0.8916	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:16	KLFPRRCTW	0.949	0.9869	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:17	KLFPRRCTW	0.9465	0.9897	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B57:03	KLFPRRCTW	0.9348	0.9985	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B50:02	AEKLFPRRC	0.8642	0.5298	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B47:01	REAEKLFPR	0.8394	0.5008	8	17
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B41:01	AEKLFPRRC	0.2245	0.9597	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B50:01	AEKLFPRRC	0.0021	0.622	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:02	AEKLFPRRCTW	0.9992	0.9447	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:03	AEKLFPRRCTW	0.9989	0.9861	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A29:10	KLFPRRCTWLY	0.9988	0.6698	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:05	AEKLFPRRCTW	0.9961	0.9794	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A80:01	KLFPRRCTWLY	0.964	0.7298	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A74:09	KLFPRRCTWLY	0.9531	0.816	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A74:11	KLFPRRCTWLY	0.9531	0.816	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A74:03	KLFPRRCTWLY	0.9531	0.816	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A01:06	KLFPRRCTWLY	0.9529	0.544	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A31:08	KLFPRRCTWLY	0.9528	0.5776	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A32:13	KLFPRRCTWLY	0.9429	0.9944	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B40:06	AEKLFPRRC	0.975	0.6523	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:07	KLFPRRCTW	0.5346	0.9674	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:08	KLFPRRCTW	0.0858	0.943	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-C04:10	LFDDTREAEKL	1	0.799	3	14
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-C04:07	LFDDTREAEKL	1	0.7718	3	14
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-C04:14	LFDDTREAEKL	0.9997	0.8216	3	14
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A29:01	KLFPRRCTWLY	0.9988	0.6698	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A29:02	KLFPRRCTWLY	0.9988	0.6698	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:08	AEKLFPRRCTW	0.9988	0.9618	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:04	AEKLFPRRCTW	0.998	0.9178	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:07	KLFPRRCTWLY	0.9969	0.9266	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A32:01	KLFPRRCTW	0.997	0.9972	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B57:10	KLFPRRCTW	0.9967	0.9971	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B57:04	KLFPRRCTW	0.9861	0.9437	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A25:01	DTREAEKLF	0.9821	0.8629	6	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B58:06	KLFPRRCTW	0.9593	0.993	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:24	KLFPRRCTW	0.923	0.9953	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:13	KLFPRRCTW	0.7886	0.9763	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B57:02	KLFPRRCTW	0.7402	0.993	12	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B50:04	AEKLFPRRC	0.0021	0.622	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B50:05	AEKLFPRRC	0.0021	0.622	10	19
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-C18:01	LFDDTREAEKL	1	0.7785	3	14
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-C04:01	LFDDTREAEKL	1	0.7718	3	14
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:22	AEKLFPRRCTW	0.9992	0.9447	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:26	AEKLFPRRCTW	0.9989	0.9861	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:07	AEKLFPRRCTW	0.9989	0.9861	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:13	AEKLFPRRCTW	0.9989	0.9861	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B44:21	AEKLFPRRCTW	0.998	0.8436	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-B15:35	KLFPRRCTWLY	0.9962	0.9705	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A30:02	KLFPRRCTWLY	0.9848	0.5618	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A32:01	KLFPRRCTWLY	0.982	0.9945	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A30:04	KLFPRRCTWLY	0.9803	0.653	12	23
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A32:01	AEKLFPRRCTW	0.9757	0.998	10	21
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	HLA-A74:01	KLFPRRCTWLY	0.9531	0.816	12	23

Top

Potential FusionNeoAntigen Information of RAB3GAP1-MAP4K3 in HLA II

RAB3GAP1-MAP4K3_135911446_39499683.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-0310	QRRLFDDTREAEKLF	0	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-0315	QRRLFDDTREAEKLF	0	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-0326	QRRLFDDTREAEKLF	0	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-1333	QRRLFDDTREAEKLF	0	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-1388	QRRLFDDTREAEKLF	0	15
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	2332	DRB1-1394	QRRLFDDTREAEKLF	0	15

Top

Fusion breakpoint peptide structures of RAB3GAP1-MAP4K3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1439	DTREAEKLFPRRCT	RAB3GAP1	MAP4K3	chr2	135911446	chr2	39499683	2332

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RAB3GAP1-MAP4K3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1439	DTREAEKLFPRRCT	-7.9962	-8.1096
HLA-B14:02	3BVN	1439	DTREAEKLFPRRCT	-5.70842	-6.74372
HLA-B52:01	3W39	1439	DTREAEKLFPRRCT	-6.83737	-6.95077
HLA-B52:01	3W39	1439	DTREAEKLFPRRCT	-4.4836	-5.5189
HLA-A11:01	4UQ2	1439	DTREAEKLFPRRCT	-10.0067	-10.1201
HLA-A11:01	4UQ2	1439	DTREAEKLFPRRCT	-9.03915	-10.0745
HLA-A24:02	5HGA	1439	DTREAEKLFPRRCT	-6.56204	-6.67544
HLA-A24:02	5HGA	1439	DTREAEKLFPRRCT	-5.42271	-6.45801
HLA-B44:05	3DX8	1439	DTREAEKLFPRRCT	-7.85648	-8.89178
HLA-B44:05	3DX8	1439	DTREAEKLFPRRCT	-5.3978	-5.5112
HLA-A02:01	6TDR	1439	DTREAEKLFPRRCT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of RAB3GAP1-MAP4K3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	10	19	AEKLFPRRC	GCAGAAAAGCTATTCCCTCGAAGGTGT
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	10	21	AEKLFPRRCTW	GCAGAAAAGCTATTCCCTCGAAGGTGTACATGG
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	12	21	KLFPRRCTW	AAGCTATTCCCTCGAAGGTGTACATGG
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	12	23	KLFPRRCTWLY	AAGCTATTCCCTCGAAGGTGTACATGGTTGTAT
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	3	14	LFDDTREAEKL	CTCTTTGATGATACACGGGAAGCAGAAAAGCTA
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	6	15	DTREAEKLF	GATACACGGGAAGCAGAAAAGCTATTC
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	8	17	REAEKLFPR	CGGGAAGCAGAAAAGCTATTCCCTCGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
RAB3GAP1-MAP4K3	chr2	135911446	chr2	39499683	0	15	QRRLFDDTREAEKLF	CAAAGGAGACTCTTTGATGATACACGGGAAGCAGAAAAGCTATTC

Top

Information of the samples that have these potential fusion neoantigens of RAB3GAP1-MAP4K3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	RAB3GAP1-MAP4K3	chr2	135911446	ENST00000264158	chr2	39499683	ENST00000263881	TCGA-E2-A10A-01A

Top

Potential target of CAR-T therapy development for RAB3GAP1-MAP4K3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RAB3GAP1-MAP4K3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RAB3GAP1-MAP4K3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)