Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RABEP1-ASPA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RABEP1-ASPA
	FusionPDB ID: 71515
	FusionGDB2.0 ID: 71515
		Hgene	Tgene
	Gene symbol	RABEP1	ASPA
	Gene ID	9135	443
	Gene name	rabaptin, RAB GTPase binding effector protein 1	aspartoacylase
	Synonyms	RAB5EP\|RABPT5	ACY2\|ASP
	Cytomap	17p13.2	17p13.2
	Type of gene	protein-coding	protein-coding
	Description	rab GTPase-binding effector protein 1neurocrescinrabaptin-4rabaptin-5rabaptin-5alpharenal carcinoma antigen NY-REN-17	aspartoacylaseACY-2aminoacylase 2
	Modification date	20200313	20200313
	UniProtAcc	.	DRICH1,C22orf43 Main function of 5'-partner protein: 229
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262477, ENST00000341923, ENST00000408982, ENST00000537505, ENST00000546142, ENST00000570487,	ENST00000263080, ENST00000456349,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 10 X 8=1120	3 X 4 X 3=36
	# samples	17	4
	** MAII score	log2(17/1120*10)=-2.71989208080726 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: RABEP1 [Title/Abstract] AND ASPA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RABEP1 [Title/Abstract] AND ASPA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RABEP1(5185815)-ASPA(3397644), # samples:3
Anticipated loss of major functional domain due to fusion event.	RABEP1-ASPA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RABEP1-ASPA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:5185815/chr17:3397644)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RABEP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ASPA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000408982	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397644	+	566	258	155	565	137
ENST00000408982	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397644	+	4897	258	155	565	136
ENST00000262477	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397644	+	566	258	155	565	137
ENST00000262477	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397644	+	4897	258	155	565	136
ENST00000537505	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397644	+	555	247	144	554	136
ENST00000537505	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397644	+	4886	247	144	554	136
ENST00000546142	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397644	+	529	221	118	528	137
ENST00000546142	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397644	+	4860	221	118	528	136
ENST00000341923	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397644	+	342	34	0	341	113
ENST00000341923	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397644	+	4673	34	0	341	113
ENST00000408982	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397643	+	566	258	155	565	137
ENST00000408982	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397643	+	4897	258	155	565	136
ENST00000262477	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397643	+	566	258	155	565	137
ENST00000262477	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397643	+	4897	258	155	565	136
ENST00000537505	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397643	+	555	247	144	554	136
ENST00000537505	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397643	+	4886	247	144	554	136
ENST00000546142	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397643	+	529	221	118	528	137
ENST00000546142	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397643	+	4860	221	118	528	136
ENST00000341923	RABEP1	chr17	5185815	+	ENST00000456349	ASPA	chr17	3397643	+	342	34	0	341	113
ENST00000341923	RABEP1	chr17	5185815	+	ENST00000263080	ASPA	chr17	3397643	+	4673	34	0	341	113

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000408982	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.010524099	0.98947585
ENST00000408982	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.020762062	0.97923785
ENST00000262477	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.010524099	0.98947585
ENST00000262477	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.020762062	0.97923785
ENST00000537505	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.012482086	0.9875179
ENST00000537505	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.02065573	0.9793443
ENST00000546142	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.015030976	0.984969
ENST00000546142	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.020523159	0.97947687
ENST00000341923	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.018016187	0.9819838
ENST00000341923	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397644	+	0.021717358	0.97828263
ENST00000408982	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.010524099	0.98947585
ENST00000408982	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.020762062	0.97923785
ENST00000262477	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.010524099	0.98947585
ENST00000262477	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.020762062	0.97923785
ENST00000537505	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.012482086	0.9875179
ENST00000537505	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.02065573	0.9793443
ENST00000546142	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.015030976	0.984969
ENST00000546142	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.020523159	0.97947687
ENST00000341923	ENST00000456349	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.018016187	0.9819838
ENST00000341923	ENST00000263080	RABEP1	chr17	5185815	+	ASPA	chr17	3397643	+	0.021717358	0.97828263

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RABEP1-ASPA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RABEP1	chr17	5185815	ASPA	chr17	3397643	221	34	LVMAQPGPASQPDGKEFPPCAIEVYK
RABEP1	chr17	5185815	ASPA	chr17	3397643	247	34	LVMAQPGPASQPDGKEFPPCAIEVYK
RABEP1	chr17	5185815	ASPA	chr17	3397643	258	34	LVMAQPGPASQPDGKEFPPCAIEVYK
RABEP1	chr17	5185815	ASPA	chr17	3397644	221	34	LVMAQPGPASQPDGKEFPPCAIEVYK
RABEP1	chr17	5185815	ASPA	chr17	3397644	247	34	LVMAQPGPASQPDGKEFPPCAIEVYK
RABEP1	chr17	5185815	ASPA	chr17	3397644	258	34	LVMAQPGPASQPDGKEFPPCAIEVYK

Top

Potential FusionNeoAntigen Information of RABEP1-ASPA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RABEP1-ASPA_5185815_3397643.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B15:17	ASQPDGKEF	0.969	0.9827	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B15:16	ASQPDGKEF	0.967	0.9613	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B58:02	ASQPDGKEF	0.9472	0.9869	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B46:01	ASQPDGKEF	0.9437	0.5494	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B57:03	ASQPDGKEF	0.8834	0.9958	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B08:09	DGKEFPPCA	0.4439	0.7525	12	21
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C15:04	ASQPDGKEF	0.9835	0.9526	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C03:07	ASQPDGKEF	0.9797	0.9881	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C12:12	ASQPDGKEF	0.8291	0.9461	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C03:14	ASQPDGKEF	0.7149	0.9851	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C03:02	ASQPDGKEF	0.9966	0.9834	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C15:09	ASQPDGKEF	0.9835	0.9526	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B57:04	ASQPDGKEF	0.9819	0.8994	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B58:06	ASQPDGKEF	0.9769	0.9752	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-B57:02	ASQPDGKEF	0.9329	0.9738	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C12:02	ASQPDGKEF	0.8923	0.97	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C16:01	ASQPDGKEF	0.6885	0.9808	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C16:02	ASQPDGKEF	0.6556	0.995	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C02:02	ASQPDGKEF	0.4158	0.9875	8	17
RABEP1-ASPA	chr17	5185815	chr17	3397643	258	HLA-C02:10	ASQPDGKEF	0.4158	0.9875	8	17

Top

Potential FusionNeoAntigen Information of RABEP1-ASPA in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RABEP1-ASPA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3011	GPASQPDGKEFPPC	RABEP1	ASPA	chr17	5185815	chr17	3397643	258

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RABEP1-ASPA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3011	GPASQPDGKEFPPC	-7.9962	-8.1096
HLA-B14:02	3BVN	3011	GPASQPDGKEFPPC	-5.70842	-6.74372
HLA-B52:01	3W39	3011	GPASQPDGKEFPPC	-6.83737	-6.95077
HLA-B52:01	3W39	3011	GPASQPDGKEFPPC	-4.4836	-5.5189
HLA-A11:01	4UQ2	3011	GPASQPDGKEFPPC	-10.0067	-10.1201
HLA-A11:01	4UQ2	3011	GPASQPDGKEFPPC	-9.03915	-10.0745
HLA-A24:02	5HGA	3011	GPASQPDGKEFPPC	-6.56204	-6.67544
HLA-A24:02	5HGA	3011	GPASQPDGKEFPPC	-5.42271	-6.45801
HLA-B44:05	3DX8	3011	GPASQPDGKEFPPC	-7.85648	-8.89178
HLA-B44:05	3DX8	3011	GPASQPDGKEFPPC	-5.3978	-5.5112
HLA-A02:01	6TDR	3011	GPASQPDGKEFPPC	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of RABEP1-ASPA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RABEP1-ASPA	chr17	5185815	chr17	3397643	12	21	DGKEFPPCA	ACGGAAAAGAATTTCCTCCCTGCGCCA
RABEP1-ASPA	chr17	5185815	chr17	3397643	8	17	ASQPDGKEF	CTTCCCAGCCTGACGGAAAAGAATTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RABEP1-ASPA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	RABEP1-ASPA	chr17	5185815	ENST00000262477	chr17	3397643	ENST00000263080	TCGA-A2-A25B

Top

Potential target of CAR-T therapy development for RABEP1-ASPA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RABEP1-ASPA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RABEP1-ASPA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)