Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RB1-RP2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RB1-RP2
	FusionPDB ID: 72571
	FusionGDB2.0 ID: 72571
		Hgene	Tgene
	Gene symbol	RB1	RP2
	Gene ID	5925	390916
	Gene name	RB transcriptional corepressor 1	nudix hydrolase 19
	Synonyms	OSRC\|PPP1R130\|RB\|p105-Rb\|p110-RB1\|pRb\|pp110	RP2
	Cytomap	13q14.2	19q13.11
	Type of gene	protein-coding	protein-coding
	Description	retinoblastoma-associated proteinGOS563 exon 17 substitution mutation causes premature stopexon 17 tumor GOS561 substitution mutation causes premature stopprepro-retinoblastoma-associated proteinprotein phosphatase 1, regulatory subunit 130retinoblas	nucleoside diphosphate-linked moiety X motif 19CTC-379B2.4nucleoside diphosphate-linked moiety X motif 19, mitochondrialnudix (nucleoside diphosphate linked moiety X)-type motif 19nudix motif 19
	Modification date	20200329	20200313
	UniProtAcc	RB1CC1 Main function of 5'-partner protein: 1594	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000267163, ENST00000484879,	ENST00000218340,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 9 X 13=2691	2 X 2 X 2=8
	# samples	27	2
	** MAII score	log2(27/2691*10)=-3.31711107858959 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/8*10)=1.32192809488736
Fusion gene context	PubMed: RB1 [Title/Abstract] AND RP2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RB1 [Title/Abstract] AND RP2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RB1(48955579)-RP2(46712910), # samples:1
Anticipated loss of major functional domain due to fusion event.	RB1-RP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RB1-RP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RB1-RP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RB1-RP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RB1	GO:0043550	regulation of lipid kinase activity	16286473
Hgene	RB1	GO:0045892	negative regulation of transcription, DNA-templated	10783144\|12065415\|19223331
Hgene	RB1	GO:2000679	positive regulation of transcription regulatory region DNA binding	25100735

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr13:48955579/chrX:46712910)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RB1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RP2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000267163

RB1

chr13

48955579

ENST00000218340

RP2

chrX

46712910

5373

1833

138

2783

881

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000267163	ENST00000218340	RB1	chr13	48955579	+	RP2	chrX	46712910	+	9.61E-05	0.9999039

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RB1-RP2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RB1	chr13	48955579	RP2	chrX	46712910	1833	563	ERCEHRIMESLAWLSVDPKDYMFSGL

Top

Potential FusionNeoAntigen Information of RB1-RP2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RB1-RP2_48955579_46712910.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B45:01	MESLAWLSV	0.9977	0.9825	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:22	RIMESLAWL	0.9941	0.6	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:30	RIMESLAWL	0.9931	0.6448	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:67	RIMESLAWL	0.9931	0.6448	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:24	RIMESLAWL	0.9931	0.6448	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:60	RIMESLAWL	0.9929	0.639	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:21	RIMESLAWL	0.9927	0.7313	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:04	RIMESLAWL	0.9925	0.6928	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:11	RIMESLAWL	0.9924	0.6824	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:17	RIMESLAWL	0.9912	0.7212	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:27	RIMESLAWL	0.9886	0.7205	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:16	RIMESLAWL	0.9882	0.519	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:13	RIMESLAWL	0.9872	0.8337	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:38	RIMESLAWL	0.9838	0.8209	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:35	RIMESLAWL	0.9797	0.6632	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:29	RIMESLAWL	0.9503	0.6462	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:19	RIMESLAWL	0.9431	0.5193	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:20	RIMESLAWL	0.9348	0.6466	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B50:01	MESLAWLSV	0.8263	0.9763	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B27:04	HRIMESLAWL	0.9999	0.7353	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B27:07	HRIMESLAWL	0.9998	0.5008	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B39:24	HRIMESLAWL	0.9972	0.7304	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B39:01	HRIMESLAWL	0.9954	0.9005	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B07:10	HRIMESLAWL	0.3602	0.5752	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:13	RIMESLAWLSV	0.9991	0.841	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:27	RIMESLAWLSV	0.999	0.7652	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:11	RIMESLAWLSV	0.9985	0.7591	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:60	RIMESLAWLSV	0.9984	0.7323	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:38	RIMESLAWLSV	0.9984	0.83	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:21	RIMESLAWLSV	0.9983	0.809	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:67	RIMESLAWLSV	0.9983	0.7367	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:24	RIMESLAWLSV	0.9983	0.7367	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:30	RIMESLAWLSV	0.9983	0.7367	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:04	RIMESLAWLSV	0.9979	0.7764	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:16	RIMESLAWLSV	0.9974	0.5271	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:35	RIMESLAWLSV	0.9936	0.7464	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:29	RIMESLAWLSV	0.9845	0.7392	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:20	RIMESLAWLSV	0.9718	0.7416	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B40:06	MESLAWLSV	0.9991	0.818	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:02	RIMESLAWL	0.9943	0.5014	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:05	RIMESLAWL	0.9936	0.5909	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:07	RIMESLAWL	0.9934	0.6674	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:01	RIMESLAWL	0.9931	0.6448	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B39:12	HRIMESLAWL	0.995	0.9061	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:01	RIMESLAWLSV	0.9983	0.7367	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:14	RIMESLAWL	0.9929	0.6996	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:06	RIMESLAWL	0.9927	0.7313	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B40:04	MESLAWLSV	0.9916	0.9528	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:03	RIMESLAWL	0.9878	0.7284	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A32:01	RIMESLAWL	0.982	0.9814	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B50:04	MESLAWLSV	0.8263	0.9763	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B50:05	MESLAWLSV	0.8263	0.9763	7	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-C17:01	RIMESLAWL	0.6093	0.9819	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B40:21	RIMESLAWL	0.0905	0.5583	5	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B27:08	HRIMESLAWL	0.9999	0.6337	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B27:09	HRIMESLAWL	0.9998	0.6729	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B27:06	HRIMESLAWL	0.9998	0.739	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-B39:31	HRIMESLAWL	0.9957	0.9043	4	14
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:03	RIMESLAWLSV	0.9994	0.8021	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:14	RIMESLAWLSV	0.9984	0.7781	5	16
RB1-RP2	chr13	48955579	chrX	46712910	1833	HLA-A02:06	RIMESLAWLSV	0.9983	0.809	5	16

Top

Potential FusionNeoAntigen Information of RB1-RP2 in HLA II

RB1-RP2_48955579_46712910.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RB1-RP2	chr13	48955579	chrX	46712910	1833	DRB1-0310	LAWLSVDPKDYMFSG	10	25
RB1-RP2	chr13	48955579	chrX	46712910	1833	DRB1-0320	LAWLSVDPKDYMFSG	10	25
RB1-RP2	chr13	48955579	chrX	46712910	1833	DRB1-0326	LAWLSVDPKDYMFSG	10	25

Top

Fusion breakpoint peptide structures of RB1-RP2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3831	IMESLAWLSVDPKD	RB1	RP2	chr13	48955579	chrX	46712910	1833

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RB1-RP2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3831	IMESLAWLSVDPKD	-7.74923	-7.86263
HLA-B14:02	3BVN	3831	IMESLAWLSVDPKD	-5.89384	-6.92914
HLA-B52:01	3W39	3831	IMESLAWLSVDPKD	-4.71605	-5.75135
HLA-B52:01	3W39	3831	IMESLAWLSVDPKD	-4.60517	-4.71857
HLA-A11:01	4UQ2	3831	IMESLAWLSVDPKD	-3.55615	-4.59145
HLA-A24:02	5HGA	3831	IMESLAWLSVDPKD	-6.20641	-6.31981
HLA-A24:02	5HGA	3831	IMESLAWLSVDPKD	-4.60823	-5.64353
HLA-B44:05	3DX8	3831	IMESLAWLSVDPKD	-5.79986	-5.91326
HLA-B44:05	3DX8	3831	IMESLAWLSVDPKD	-4.0772	-5.1125

Top

Vaccine Design for the FusionNeoAntigens of RB1-RP2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RB1-RP2	chr13	48955579	chrX	46712910	4	14	HRIMESLAWL	ATCATGGAATCCCTTGCATGGCTCTCAGTT
RB1-RP2	chr13	48955579	chrX	46712910	5	14	RIMESLAWL	ATGGAATCCCTTGCATGGCTCTCAGTT
RB1-RP2	chr13	48955579	chrX	46712910	5	16	RIMESLAWLSV	ATGGAATCCCTTGCATGGCTCTCAGTTGATCCA
RB1-RP2	chr13	48955579	chrX	46712910	7	16	MESLAWLSV	TCCCTTGCATGGCTCTCAGTTGATCCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
RB1-RP2	chr13	48955579	chrX	46712910	10	25	LAWLSVDPKDYMFSG	TGGCTCTCAGTTGATCCAAAAGACTACATGTTCAGTGGACTGAAG

Top

Information of the samples that have these potential fusion neoantigens of RB1-RP2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	RB1-RP2	chr13	48955579	ENST00000267163	chrX	46712910	ENST00000218340	149N

Top

Potential target of CAR-T therapy development for RB1-RP2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RB1-RP2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RB1-RP2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)