![]() |
|||||||
|
Fusion Protein:RCOR1-KIT |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: RCOR1-KIT | FusionPDB ID: 73326 | FusionGDB2.0 ID: 73326 | Hgene | Tgene | Gene symbol | RCOR1 | KIT | Gene ID | 23186 | 3815 |
Gene name | REST corepressor 1 | KIT proto-oncogene, receptor tyrosine kinase | |
Synonyms | COREST|RCOR | C-Kit|CD117|MASTC|PBT|SCFR | |
Cytomap | 14q32.31-q32.32 | 4q12 | |
Type of gene | protein-coding | protein-coding | |
Description | REST corepressor 1 | mast/stem cell growth factor receptor Kitc-Kit protooncogenep145 c-kitpiebald trait proteinproto-oncogene c-Kitproto-oncogene tyrosine-protein kinase Kitsoluble KIT variant 1tyrosine-protein kinase Kitv-kit Hardy-Zuckerman 4 feline sarcoma viral o | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | P21583 Main function of 5'-partner protein: FUNCTION: Ligand for the receptor-type protein-tyrosine kinase KIT. Plays an essential role in the regulation of cell survival and proliferation, hematopoiesis, stem cell maintenance, gametogenesis, mast cell development, migration and function, and in melanogenesis. KITLG/SCF binding can activate several signaling pathways. Promotes phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, and subsequent activation of the kinase AKT1. KITLG/SCF and KIT also transmit signals via GRB2 and activation of RAS, RAF1 and the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1. KITLG/SCF and KIT promote activation of STAT family members STAT1, STAT3 and STAT5. KITLG/SCF and KIT promote activation of PLCG1, leading to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. KITLG/SCF acts synergistically with other cytokines, probably interleukins. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000262241, ENST00000570597, | ENST00000288135, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 9 X 10=900 | 4 X 4 X 3=48 |
# samples | 20 | 4 | |
** MAII score | log2(20/900*10)=-2.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: RCOR1 [Title/Abstract] AND KIT [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: RCOR1 [Title/Abstract] AND KIT [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | RCOR1(103148315)-KIT(55561678), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | RCOR1-KIT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RCOR1-KIT seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RCOR1-KIT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RCOR1-KIT seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | RCOR1 | GO:0045892 | negative regulation of transcription, DNA-templated | 10449787 |
Hgene | RCOR1 | GO:0070933 | histone H4 deacetylation | 17555596 |
Tgene | KIT | GO:0000187 | activation of MAPK activity | 21640708 |
Tgene | KIT | GO:0002551 | mast cell chemotaxis | 20100931 |
Tgene | KIT | GO:0018108 | peptidyl-tyrosine phosphorylation | 21640708 |
Tgene | KIT | GO:0019221 | cytokine-mediated signaling pathway | 21640708 |
Tgene | KIT | GO:0031532 | actin cytoskeleton reorganization | 1721869 |
Tgene | KIT | GO:0032762 | mast cell cytokine production | 20100931 |
Tgene | KIT | GO:0038093 | Fc receptor signaling pathway | 20100931 |
Tgene | KIT | GO:0038109 | Kit signaling pathway | 17662946 |
Tgene | KIT | GO:0046777 | protein autophosphorylation | 21640708 |
Tgene | KIT | GO:0060326 | cell chemotaxis | 1721869 |
Tgene | KIT | GO:1905065 | positive regulation of vascular smooth muscle cell differentiation | 19088079 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:103148315/chr4:55561678) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000262241 | RCOR1 | chr14 | 103148315 | - | ENST00000288135 | KIT | chr4 | 55561678 | + | 5693 | 671 | 25 | 3534 | 1169 |
ENST00000570597 | RCOR1 | chr14 | 103148315 | - | ENST00000288135 | KIT | chr4 | 55561678 | + | 5458 | 436 | 0 | 3299 | 1099 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000262241 | ENST00000288135 | RCOR1 | chr14 | 103148315 | - | KIT | chr4 | 55561678 | + | 0.000169576 | 0.99983037 |
ENST00000570597 | ENST00000288135 | RCOR1 | chr14 | 103148315 | - | KIT | chr4 | 55561678 | + | 0.000124869 | 0.99987507 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for RCOR1-KIT |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
RCOR1 | chr14 | 103148315 | KIT | chr4 | 55561678 | 436 | 135 | RSQERDNLGMLVWSPNQNLSEAKCSS |
RCOR1 | chr14 | 103148315 | KIT | chr4 | 55561678 | 671 | 205 | RSQERDNLGMLVWSPNQNLSEAKCSS |
Top |
Potential FusionNeoAntigen Information of RCOR1-KIT in HLA I |
![]() |
RCOR1-KIT_103148315_55561678.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:35 | LVWSPNQNL | 0.8677 | 0.6046 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:21 | LVWSPNQNL | 0.8592 | 0.7391 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:20 | LVWSPNQNL | 0.8178 | 0.6027 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:07 | LVWSPNQNL | 0.9987 | 0.9425 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:08 | LVWSPNQNL | 0.9986 | 0.8564 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C15:06 | LVWSPNQNL | 0.9971 | 0.8644 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:07 | LVWSPNQNL | 0.8304 | 0.562 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:03 | LVWSPNQNL | 0.9986 | 0.9761 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:04 | LVWSPNQNL | 0.9986 | 0.9761 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:05 | LVWSPNQNL | 0.9958 | 0.8708 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C03:06 | LVWSPNQNL | 0.9857 | 0.9772 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:14 | LVWSPNQNL | 0.8641 | 0.6373 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A02:06 | LVWSPNQNL | 0.8592 | 0.7391 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A32:01 | LVWSPNQNL | 0.794 | 0.9202 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-A69:01 | LVWSPNQNL | 0.7274 | 0.7461 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-B15:30 | LVWSPNQNL | 0.6278 | 0.7485 | 10 | 19 |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | HLA-C17:01 | LVWSPNQNL | 0.4433 | 0.7555 | 10 | 19 |
Top |
Potential FusionNeoAntigen Information of RCOR1-KIT in HLA II |
![]() |
RCOR1-KIT_103148315_55561678.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 671 | DRB1-1525 | LGMLVWSPNQNLSEA | 7 | 22 |
Top |
Fusion breakpoint peptide structures of RCOR1-KIT |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6248 | NLGMLVWSPNQNLS | RCOR1 | KIT | chr14 | 103148315 | chr4 | 55561678 | 671 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RCOR1-KIT |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6248 | NLGMLVWSPNQNLS | -7.88887 | -8.00227 |
HLA-B14:02 | 3BVN | 6248 | NLGMLVWSPNQNLS | -6.62887 | -7.66417 |
HLA-B52:01 | 3W39 | 6248 | NLGMLVWSPNQNLS | -6.03432 | -6.14772 |
HLA-B52:01 | 3W39 | 6248 | NLGMLVWSPNQNLS | -5.0261 | -6.0614 |
HLA-A24:02 | 5HGA | 6248 | NLGMLVWSPNQNLS | -7.29115 | -7.40455 |
HLA-A24:02 | 5HGA | 6248 | NLGMLVWSPNQNLS | -4.43115 | -5.46645 |
HLA-B27:05 | 6PYJ | 6248 | NLGMLVWSPNQNLS | -8.89142 | -9.00482 |
HLA-B44:05 | 3DX8 | 6248 | NLGMLVWSPNQNLS | -5.8503 | -5.9637 |
HLA-B44:05 | 3DX8 | 6248 | NLGMLVWSPNQNLS | -4.04938 | -5.08468 |
HLA-A02:01 | 6TDR | 6248 | NLGMLVWSPNQNLS | -5.90182 | -6.01522 |
Top |
Vaccine Design for the FusionNeoAntigens of RCOR1-KIT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 10 | 19 | LVWSPNQNL | AAGCAAAGTGCTCTTCTCAACCATCTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
RCOR1-KIT | chr14 | 103148315 | chr4 | 55561678 | 7 | 22 | LGMLVWSPNQNLSEA | ATCTGTCAGAAGCAAAGTGCTCTTCTCAACCATCTGTGAGTCCAG |
Top |
Information of the samples that have these potential fusion neoantigens of RCOR1-KIT |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
PRAD | RCOR1-KIT | chr14 | 103148315 | ENST00000262241 | chr4 | 55561678 | ENST00000288135 | TCGA-EJ-7327-01A |
Top |
Potential target of CAR-T therapy development for RCOR1-KIT |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | KIT | chr14:103148315 | chr4:55561678 | ENST00000288135 | 0 | 21 | 525_545 | 0 | 977.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to RCOR1-KIT |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to RCOR1-KIT |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |