|
|||||||
|
Fusion Protein:RLF-SFPQ |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
| Fusion partner gene information | Fusion gene name: RLF-SFPQ | FusionPDB ID: 74220 | FusionGDB2.0 ID: 74220 | Hgene | Tgene | Gene symbol | RLF | SFPQ | Gene ID | 6018 | 654780 |
| Gene name | RLF zinc finger | splicing factor proline/glutamine-rich | |
| Synonyms | ZN-15L|ZNF292L | SFPQ | |
| Cytomap | 1p34.2 | 16q24.1 | |
| Type of gene | protein-coding | ncRNA | |
| Description | zinc finger protein RlfZn-15 relatedrearranged L-myc fusion gene proteinrearranged L-myc fusion sequencezn-15-related protein | - | |
| Modification date | 20200313 | 20200303 | |
| UniProtAcc | . | P23246 Main function of 5'-partner protein: FUNCTION: DNA- and RNA binding protein, involved in several nuclear processes. Essential pre-mRNA splicing factor required early in spliceosome formation and for splicing catalytic step II, probably as a heteromer with NONO. Binds to pre-mRNA in spliceosome C complex, and specifically binds to intronic polypyrimidine tracts. Involved in regulation of signal-induced alternative splicing. During splicing of PTPRC/CD45, a phosphorylated form is sequestered by THRAP3 from the pre-mRNA in resting T-cells; T-cell activation and subsequent reduced phosphorylation is proposed to lead to release from THRAP3 allowing binding to pre-mRNA splicing regulatotry elements which represses exon inclusion. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. May be involved in a pre-mRNA coupled splicing and polyadenylation process as component of a snRNP-free complex with SNRPA/U1A. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. SFPQ may be involved in homologous DNA pairing; in vitro, promotes the invasion of ssDNA between a duplex DNA and produces a D-loop formation. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1; in vitro, stimulates dissociation of TOP1 from DNA after cleavage and enhances its jumping between separate DNA helices. The SFPQ-NONO heteromer binds DNA (PubMed:25765647). The SFPQ-NONO heteromer may be involved in DNA non-homologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends; in vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. SFPQ is involved in transcriptional regulation. Functions as transcriptional activator (PubMed:25765647). Transcriptional repression is mediated by an interaction of SFPQ with SIN3A and subsequent recruitment of histone deacetylases (HDACs). The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional activity. SFPQ isoform Long binds to the DNA binding domains (DBD) of nuclear hormone receptors, like RXRA and probably THRA, and acts as transcriptional corepressor in absence of hormone ligands. Binds the DNA sequence 5'-CTGAGTC-3' in the insulin-like growth factor response element (IGFRE) and inhibits IGF-I-stimulated transcriptional activity. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer. Required for the transcriptional repression of circadian target genes, such as PER1, mediated by the large PER complex through histone deacetylation (By similarity). Required for the assembly of nuclear speckles (PubMed:25765647). Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). {ECO:0000250|UniProtKB:Q8VIJ6, ECO:0000269|PubMed:10847580, ECO:0000269|PubMed:10858305, ECO:0000269|PubMed:10931916, ECO:0000269|PubMed:11259580, ECO:0000269|PubMed:11525732, ECO:0000269|PubMed:11897684, ECO:0000269|PubMed:15590677, ECO:0000269|PubMed:20932480, ECO:0000269|PubMed:25765647, ECO:0000269|PubMed:28712728, ECO:0000269|PubMed:8045264, ECO:0000269|PubMed:8449401}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000372771, | ENST00000468598, ENST00000357214, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 7 X 7=637 | 23 X 15 X 8=2760 |
| # samples | 13 | 26 | |
| ** MAII score | log2(13/637*10)=-2.29278174922785 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(26/2760*10)=-3.40808473863708 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: RLF [Title/Abstract] AND SFPQ [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: RLF [Title/Abstract] AND SFPQ [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | RLF(40627308)-SFPQ(35657130), # samples:3 | ||
| Anticipated loss of major functional domain due to fusion event. | RLF-SFPQ seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RLF-SFPQ seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RLF-SFPQ seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RLF-SFPQ seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | RLF | GO:0015074 | DNA integration | 1851085 |
| Hgene | RLF | GO:0051276 | chromosome organization | 1649386 |
Four levels of functional features of fusion genesGo to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:40627308/chr1:35657130) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across RLF (5'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion gene breakpoints across SFPQ (3'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000372771 | RLF | chr1 | 40627308 | + | ENST00000357214 | SFPQ | chr1 | 35657130 | - | 3084 | 264 | 9 | 1559 | 516 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000372771 | ENST00000357214 | RLF | chr1 | 40627308 | + | SFPQ | chr1 | 35657130 | - | 0.000342613 | 0.9996574 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for RLF-SFPQ |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| RLF | chr1 | 40627308 | SFPQ | chr1 | 35657130 | 264 | 47 | ETESMVRGHRPVSPAPGASGLRPCLW |
Top |
Potential FusionNeoAntigen Information of RLF-SFPQ in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| RLF-SFPQ_40627308_35657130.msa |
Potential FusionNeoAntigen Information* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:10 | SPAPGASGL | 0.9994 | 0.5935 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:02 | SPAPGASGL | 0.9994 | 0.5464 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:05 | RPVSPAPGA | 0.9971 | 0.727 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:02 | RPVSPAPGA | 0.9969 | 0.7572 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-A30:08 | RGHRPVSPA | 0.9788 | 0.8046 | 6 | 15 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:03 | SPAPGASGL | 0.9251 | 0.6915 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:01 | SPAPGASGL | 0.9232 | 0.6148 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:08 | SPAPGASGL | 0.9156 | 0.692 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:01 | RPVSPAPGA | 0.9091 | 0.7021 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:06 | GHRPVSPAP | 0.8763 | 0.8548 | 7 | 16 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B55:01 | RPVSPAPGA | 0.8749 | 0.6306 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:02 | SPAPGASGL | 0.7355 | 0.9164 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:04 | SPAPGASGL | 0.7355 | 0.9164 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:01 | SPAPGASGL | 0.6734 | 0.8984 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B81:01 | SPAPGASGL | 0.1128 | 0.6331 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:01 | HRPVSPAPGA | 0.9302 | 0.7768 | 8 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B55:01 | HRPVSPAPGA | 0.9249 | 0.6446 | 8 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:02 | VSPAPGASGL | 0.921 | 0.5189 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:03 | VSPAPGASGL | 0.8717 | 0.5322 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:02 | VSPAPGASGL | 0.7602 | 0.8468 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:04 | VSPAPGASGL | 0.7602 | 0.8468 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B81:01 | VSPAPGASGL | 0.7475 | 0.5837 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B73:01 | HRPVSPAP | 0.9979 | 0.8008 | 8 | 16 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:12 | SPAPGASGL | 0.9955 | 0.6823 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B54:01 | RPVSPAPGA | 0.9609 | 0.8651 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B73:01 | VRGHRPVSP | 0.9468 | 0.8258 | 5 | 14 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:12 | RPVSPAPGA | 0.9293 | 0.8233 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:04 | RPVSPAPGA | 0.8353 | 0.7606 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B14:03 | SPAPGASGL | 0.7904 | 0.9062 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:10 | SPAPGASGL | 0.7474 | 0.8958 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:12 | SPAPGASGL | 0.7355 | 0.9164 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:09 | SPAPGASGL | 0.7309 | 0.6982 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:04 | RPVSPAPGA | 0.6856 | 0.7729 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B42:02 | SPAPGASGL | 0.4586 | 0.6179 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B42:01 | SPAPGASGL | 0.3504 | 0.6171 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B78:01 | RPVSPAPGA | 0.2238 | 0.7402 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C04:07 | SPAPGASGL | 0.055 | 0.9243 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C04:10 | SPAPGASGL | 0.051 | 0.9105 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C01:17 | VSPAPGASGL | 0.9885 | 0.9378 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B73:01 | HRPVSPAPGA | 0.98 | 0.9244 | 8 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C01:30 | VSPAPGASGL | 0.97 | 0.9428 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B54:01 | HRPVSPAPGA | 0.9582 | 0.9166 | 8 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:12 | VSPAPGASGL | 0.9336 | 0.6326 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:12 | VSPAPGASGL | 0.7602 | 0.8468 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:10 | VSPAPGASGL | 0.6867 | 0.8513 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B42:01 | VSPAPGASGL | 0.681 | 0.5386 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:13 | SPAPGASGL | 0.9996 | 0.864 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:22 | SPAPGASGL | 0.9994 | 0.5464 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:09 | SPAPGASGL | 0.9994 | 0.5861 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:22 | RPVSPAPGA | 0.9969 | 0.7572 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:09 | RPVSPAPGA | 0.9955 | 0.75 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-A30:01 | RGHRPVSPA | 0.9828 | 0.9066 | 6 | 15 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:23 | SPAPGASGL | 0.9249 | 0.664 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:77 | SPAPGASGL | 0.9232 | 0.6148 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:13 | SPAPGASGL | 0.9082 | 0.7022 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B55:02 | RPVSPAPGA | 0.9014 | 0.7284 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:11 | SPAPGASGL | 0.8047 | 0.7763 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B55:04 | RPVSPAPGA | 0.7742 | 0.5891 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B67:01 | SPAPGASGL | 0.7718 | 0.827 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:09 | SPAPGASGL | 0.7355 | 0.9164 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:02 | RPVSPAPGA | 0.6856 | 0.7729 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:05 | RPVSPAPGA | 0.6713 | 0.5672 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:24 | SPAPGASGL | 0.6457 | 0.6541 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:26 | RPVSPAPGA | 0.4795 | 0.584 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B39:11 | SPAPGASGL | 0.4794 | 0.8076 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B67:01 | RPVSPAPGA | 0.4399 | 0.9373 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B78:02 | SPAPGASGL | 0.3558 | 0.5179 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B15:09 | SPAPGASGL | 0.3304 | 0.6391 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B78:02 | RPVSPAPGA | 0.1729 | 0.8263 | 9 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C04:01 | SPAPGASGL | 0.055 | 0.9243 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:43 | SPAPGASGL | 0.0073 | 0.7199 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B15:08 | SPAPGASGL | 0.007 | 0.7223 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B15:11 | SPAPGASGL | 0.0063 | 0.7367 | 12 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C01:03 | VSPAPGASGL | 0.9915 | 0.9339 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-C01:02 | VSPAPGASGL | 0.989 | 0.9367 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B55:02 | HRPVSPAPGA | 0.9684 | 0.7971 | 8 | 18 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B07:22 | VSPAPGASGL | 0.921 | 0.5189 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B35:09 | VSPAPGASGL | 0.7602 | 0.8468 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B67:01 | VSPAPGASGL | 0.7302 | 0.7449 | 11 | 21 |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 | HLA-B56:05 | HRPVSPAPGA | 0.5348 | 0.5848 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of RLF-SFPQ in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of RLF-SFPQ |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7867 | RGHRPVSPAPGASG | RLF | SFPQ | chr1 | 40627308 | chr1 | 35657130 | 264 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RLF-SFPQ |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens* We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7867 | RGHRPVSPAPGASG | -8.13059 | -8.24239 |
| HLA-B14:02 | 3BVN | 7867 | RGHRPVSPAPGASG | -1.44825 | -2.49135 |
| HLA-B52:01 | 3W39 | 7867 | RGHRPVSPAPGASG | -7.36487 | -7.47667 |
| HLA-B52:01 | 3W39 | 7867 | RGHRPVSPAPGASG | -5.18523 | -6.22833 |
| HLA-A11:01 | 4UQ2 | 7867 | RGHRPVSPAPGASG | -9.7297 | -10.7728 |
| HLA-A11:01 | 4UQ2 | 7867 | RGHRPVSPAPGASG | -7.68161 | -7.79341 |
| HLA-A24:02 | 5HGA | 7867 | RGHRPVSPAPGASG | -6.90089 | -7.01269 |
| HLA-A24:02 | 5HGA | 7867 | RGHRPVSPAPGASG | -5.47721 | -6.52031 |
| HLA-B44:05 | 3DX8 | 7867 | RGHRPVSPAPGASG | -6.49821 | -7.54131 |
| HLA-B44:05 | 3DX8 | 7867 | RGHRPVSPAPGASG | -6.27125 | -6.38305 |
Top |
Vaccine Design for the FusionNeoAntigens of RLF-SFPQ |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 11 | 21 | VSPAPGASGL | TGCCAGGGGTTTAAAGCCAATTTGTCTCTC |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 12 | 21 | SPAPGASGL | CAGGGGTTTAAAGCCAATTTGTCTCTC |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 5 | 14 | VRGHRPVSP | AACTACTGCCGGAGCTTCTGCCAGGGG |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 6 | 15 | RGHRPVSPA | TACTGCCGGAGCTTCTGCCAGGGGTTT |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 7 | 16 | GHRPVSPAP | TGCCGGAGCTTCTGCCAGGGGTTTAAA |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 8 | 16 | HRPVSPAP | CGGAGCTTCTGCCAGGGGTTTAAA |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 8 | 18 | HRPVSPAPGA | CGGAGCTTCTGCCAGGGGTTTAAAGCCAAT |
| RLF-SFPQ | chr1 | 40627308 | chr1 | 35657130 | 9 | 18 | RPVSPAPGA | AGCTTCTGCCAGGGGTTTAAAGCCAAT |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of RLF-SFPQ |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BRCA | RLF-SFPQ | chr1 | 40627308 | ENST00000372771 | chr1 | 35657130 | ENST00000357214 | TCGA-A2-A0CY-01A |
Top |
Potential target of CAR-T therapy development for RLF-SFPQ |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features* Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to RLF-SFPQ |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to RLF-SFPQ |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Tgene | SFPQ | C4518356 | MiT family translocation renal cell carcinoma | 2 | ORPHANET |
| Tgene | SFPQ | C0019693 | HIV Infections | 1 | CTD_human |
| Tgene | SFPQ | C0037274 | Dermatologic disorders | 1 | CTD_human |
| Tgene | SFPQ | C0274861 | Arsenic Poisoning, Inorganic | 1 | CTD_human |
| Tgene | SFPQ | C0274862 | Nervous System, Organic Arsenic Poisoning | 1 | CTD_human |
| Tgene | SFPQ | C0311375 | Arsenic Poisoning | 1 | CTD_human |
| Tgene | SFPQ | C0751851 | Arsenic Encephalopathy | 1 | CTD_human |
| Tgene | SFPQ | C0751852 | Arsenic Induced Polyneuropathy | 1 | CTD_human |
| Tgene | SFPQ | C4505456 | HIV Coinfection | 1 | CTD_human |