Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ATIC-GIGYF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ATIC-GIGYF2
	FusionPDB ID: 7630
	FusionGDB2.0 ID: 7630
		Hgene	Tgene
	Gene symbol	ATIC	GIGYF2
	Gene ID	471	26058
	Gene name	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	GRB10 interacting GYF protein 2
	Synonyms	AICAR\|AICARFT\|HEL-S-70p\|IMPCHASE\|PURH	GYF2\|PARK11\|PERQ2\|PERQ3\|TNRC15
	Cytomap	2q35	2q37.1
	Type of gene	protein-coding	protein-coding
	Description	bifunctional purine biosynthesis protein PURH5-aminoimidazole-4-carboxamide-1-beta-D-ribonucleotide transformylase/inosinicaseAICAR formyltransferase/IMP cyclohydrolase bifunctional enzymeAICARFT/IMPCHASEepididymis secretory sperm binding protein Li 7	GRB10-interacting GYF protein 2PERQ amino acid rich, with GYF domain 3PERQ amino acid-rich with GYF domain-containing protein 2Parkinson disease (autosomal recessive, early onset) 11trinucleotide repeat-containing gene 15 protein
	Modification date	20200313	20200313
	UniProtAcc	P31939 Main function of 5'-partner protein: FUNCTION: Bifunctional enzyme that catalyzes the last two steps of purine biosynthesis (PubMed:11948179, PubMed:14756554). Acts as a transformylase that incorporates a formyl group to the AMP analog AICAR (5-amino-1-(5-phospho-beta-D-ribosyl)imidazole-4-carboxamide) to produce the intermediate formyl-AICAR (FAICAR) (PubMed:9378707, PubMed:11948179, PubMed:10985775). Can use both 10-formyldihydrofolate and 10-formyltetrahydrofolate as the formyl donor in this reaction (PubMed:10985775). Also catalyzes the cyclization of FAICAR to IMP (PubMed:11948179, PubMed:14756554). Is able to convert thio-AICAR to 6-mercaptopurine ribonucleotide, an inhibitor of purine biosynthesis used in the treatment of human leukemias (PubMed:10985775). Promotes insulin receptor/INSR autophosphorylation and is involved in INSR internalization (PubMed:25687571). {ECO:0000269\|PubMed:10985775, ECO:0000269\|PubMed:11948179, ECO:0000269\|PubMed:14756554, ECO:0000269\|PubMed:25687571, ECO:0000269\|PubMed:9378707}.	Q6Y7W6 Main function of 5'-partner protein: FUNCTION: Key component of the 4EHP-GYF2 complex, a multiprotein complex that acts as a repressor of translation initiation (PubMed:22751931, PubMed:31439631). In the 4EHP-GYF2 complex, acts as a factor that bridges EIF4E2 to ZFP36/TTP, linking translation repression with mRNA decay (PubMed:31439631). Also recruits and bridges the association of the 4EHP complex with the decapping effector protein DDX6, which is required for the ZFP36/TTP-mediated down-regulation of AU-rich mRNA (PubMed:31439631). May act cooperatively with GRB10 to regulate tyrosine kinase receptor signaling, including IGF1 and insulin receptors (PubMed:12771153). {ECO:0000269\|PubMed:12771153, ECO:0000269\|PubMed:22751931, ECO:0000269\|PubMed:31439631}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000236959, ENST00000435675, ENST00000540518,	ENST00000452341, ENST00000482666, ENST00000373563, ENST00000373566, ENST00000409196, ENST00000409451, ENST00000409480, ENST00000409547,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 9 X 4=324	17 X 18 X 6=1836
	# samples	9	19
	** MAII score	log2(9/324*10)=-1.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/1836*10)=-3.27249473508286 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ATIC [Title/Abstract] AND GIGYF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ATIC [Title/Abstract] AND GIGYF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ATIC(216184454)-GIGYF2(233612325), # samples:1
Anticipated loss of major functional domain due to fusion event.	ATIC-GIGYF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATIC-GIGYF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATIC-GIGYF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ATIC-GIGYF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	GIGYF2	GO:0016441	posttranscriptional gene silencing	27157137
Tgene	GIGYF2	GO:0061157	mRNA destabilization	27157137

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:216184454/chr2:233612325)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ATIC (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across GIGYF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000236959	ATIC	chr2	216184454	+	ENST00000373566	GIGYF2	chr2	233612325	+	8256	616	266	4540	1424
ENST00000236959	ATIC	chr2	216184454	+	ENST00000373563	GIGYF2	chr2	233612325	+	6227	616	266	4474	1402
ENST00000236959	ATIC	chr2	216184454	+	ENST00000409480	GIGYF2	chr2	233612325	+	6289	616	266	4540	1424
ENST00000236959	ATIC	chr2	216184454	+	ENST00000409547	GIGYF2	chr2	233612325	+	6242	616	266	4474	1402
ENST00000236959	ATIC	chr2	216184454	+	ENST00000409196	GIGYF2	chr2	233612325	+	6224	616	266	4456	1396
ENST00000236959	ATIC	chr2	216184454	+	ENST00000409451	GIGYF2	chr2	233612325	+	6286	616	266	4537	1423
ENST00000540518	ATIC	chr2	216184454	+	ENST00000373566	GIGYF2	chr2	233612325	+	8230	590	279	4514	1411
ENST00000540518	ATIC	chr2	216184454	+	ENST00000373563	GIGYF2	chr2	233612325	+	6201	590	279	4448	1389
ENST00000540518	ATIC	chr2	216184454	+	ENST00000409480	GIGYF2	chr2	233612325	+	6263	590	279	4514	1411
ENST00000540518	ATIC	chr2	216184454	+	ENST00000409547	GIGYF2	chr2	233612325	+	6216	590	279	4448	1389
ENST00000540518	ATIC	chr2	216184454	+	ENST00000409196	GIGYF2	chr2	233612325	+	6198	590	279	4430	1383
ENST00000540518	ATIC	chr2	216184454	+	ENST00000409451	GIGYF2	chr2	233612325	+	6260	590	279	4511	1410
ENST00000435675	ATIC	chr2	216184454	+	ENST00000373566	GIGYF2	chr2	233612325	+	8318	678	391	4602	1403
ENST00000435675	ATIC	chr2	216184454	+	ENST00000373563	GIGYF2	chr2	233612325	+	6289	678	391	4536	1381
ENST00000435675	ATIC	chr2	216184454	+	ENST00000409480	GIGYF2	chr2	233612325	+	6351	678	391	4602	1403
ENST00000435675	ATIC	chr2	216184454	+	ENST00000409547	GIGYF2	chr2	233612325	+	6304	678	391	4536	1381
ENST00000435675	ATIC	chr2	216184454	+	ENST00000409196	GIGYF2	chr2	233612325	+	6286	678	391	4518	1375
ENST00000435675	ATIC	chr2	216184454	+	ENST00000409451	GIGYF2	chr2	233612325	+	6348	678	391	4599	1402

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000236959	ENST00000373566	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.001053311	0.9989467
ENST00000236959	ENST00000373563	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003477236	0.9965228
ENST00000236959	ENST00000409480	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003458201	0.9965418
ENST00000236959	ENST00000409547	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003478834	0.99652123
ENST00000236959	ENST00000409196	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003392623	0.9966074
ENST00000236959	ENST00000409451	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.004141981	0.995858
ENST00000540518	ENST00000373566	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.001224655	0.9987753
ENST00000540518	ENST00000373563	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003968561	0.99603146
ENST00000540518	ENST00000409480	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003946721	0.9960532
ENST00000540518	ENST00000409547	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003970339	0.99602973
ENST00000540518	ENST00000409196	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003871049	0.9961289
ENST00000540518	ENST00000409451	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.004694712	0.9953053
ENST00000435675	ENST00000373566	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.001130312	0.9988697
ENST00000435675	ENST00000373563	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003567767	0.9964322
ENST00000435675	ENST00000409480	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.00355906	0.99644095
ENST00000435675	ENST00000409547	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003570284	0.99642974
ENST00000435675	ENST00000409196	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.003486554	0.9965134
ENST00000435675	ENST00000409451	ATIC	chr2	216184454	+	GIGYF2	chr2	233612325	+	0.004228185	0.9957718

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ATIC-GIGYF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ATIC	chr2	216184454	GIGYF2	chr2	233612325	590	103	DNADMARLDFNLIRLRALSSGGSITS
ATIC	chr2	216184454	GIGYF2	chr2	233612325	616	116	DNADMARLDFNLIRLRALSSGGSITS
ATIC	chr2	216184454	GIGYF2	chr2	233612325	678	95	DNADMARLDFNLIRLRALSSGGSITS

Top

Potential FusionNeoAntigen Information of ATIC-GIGYF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ATIC-GIGYF2_216184454_233612325.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:09	NLIRLRAL	0.9994	0.571	10	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:01	NLIRLRAL	0.9994	0.5545	10	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:05	ARLDFNLIR	0.9993	0.9036	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:02	ARLDFNLIR	0.9993	0.6259	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:01	FNLIRLRAL	0.998	0.7465	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:04	ARLDFNLIR	0.9961	0.7985	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:09	FNLIRLRAL	0.9961	0.7289	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:67	RLDFNLIRL	0.9914	0.5306	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:30	RLDFNLIRL	0.9914	0.5306	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:24	RLDFNLIRL	0.9914	0.5306	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:60	RLDFNLIRL	0.9912	0.5045	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:11	RLDFNLIRL	0.9906	0.56	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:04	RLDFNLIRL	0.9906	0.5701	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:21	RLDFNLIRL	0.9839	0.6394	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B14:02	FNLIRLRAL	0.9837	0.5424	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B14:01	FNLIRLRAL	0.9837	0.5424	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:22	RLDFNLIRL	0.9818	0.5221	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:27	RLDFNLIRL	0.9763	0.5238	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:38	RLDFNLIRL	0.9647	0.5905	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:13	RLDFNLIRL	0.9646	0.6033	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:29	RLDFNLIRL	0.8601	0.5376	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:20	RLDFNLIRL	0.8507	0.5342	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:35	RLDFNLIRL	0.8471	0.5803	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B13:01	RLDFNLIRL	0.1254	0.8919	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:02	ARLDFNLIRL	1	0.6456	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:05	ARLDFNLIRL	0.9999	0.903	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:04	ARLDFNLIRL	0.9999	0.807	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:05	MARLDFNLIR	0.9753	0.8318	4	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:05	ARLDFNLIRLR	0.9999	0.8507	5	16
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C05:09	RLDFNLIRL	0.9999	0.9284	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:10	RLDFNLIRL	0.9998	0.753	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:07	RLDFNLIRL	0.9998	0.7539	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C08:15	RLDFNLIRL	0.9995	0.9809	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:14	ARLDFNLIR	0.9992	0.8271	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:07	RLDFNLIRL	0.9921	0.5744	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:01	RLDFNLIRL	0.9914	0.5306	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:03	ARLDFNLIR	0.9794	0.913	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:14	RLDFNLIRL	0.9428	0.7615	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:06	RLDFNLIRL	0.9313	0.7959	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B14:03	FNLIRLRAL	0.6085	0.7107	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:14	ARLDFNLIRL	0.9999	0.8337	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:03	ARLDFNLIRL	0.9986	0.9114	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:14	MARLDFNLIR	0.9724	0.7005	4	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:07	ARLDFNLIRL	0.6831	0.5831	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:03	MARLDFNLIR	0.6809	0.8605	4	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:14	ARLDFNLIRLR	0.9999	0.8135	5	16
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:03	ARLDFNLIRLR	0.9956	0.864	5	16
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:18	NLIRLRAL	0.9994	0.5545	10	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:12	NLIRLRAL	0.9599	0.7072	10	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C05:01	RLDFNLIRL	0.9999	0.9284	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:03	RLDFNLIRL	0.9999	0.7967	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:01	RLDFNLIRL	0.9998	0.7539	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C18:01	RLDFNLIRL	0.9997	0.7779	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C08:02	RLDFNLIRL	0.9995	0.9809	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C01:03	RLDFNLIRL	0.9993	0.9204	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:08	ARLDFNLIR	0.9993	0.8231	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:10	ARLDFNLIR	0.9987	0.9104	5	14
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:18	FNLIRLRAL	0.998	0.7465	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:06	RLDFNLIRL	0.9839	0.6394	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-A02:14	RLDFNLIRL	0.9836	0.5643	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B08:12	FNLIRLRAL	0.9802	0.8398	9	18
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C04:04	RLDFNLIRL	0.9314	0.7784	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C17:01	RLDFNLIRL	0.8139	0.6913	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C07:04	RLDFNLIRL	0.6943	0.9242	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B07:13	RLDFNLIRL	0.1747	0.7274	6	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:10	ARLDFNLIRL	0.9999	0.9127	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:08	ARLDFNLIRL	0.9999	0.8288	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:06	ARLDFNLIRL	0.9999	0.8173	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:09	ARLDFNLIRL	0.9999	0.8925	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-C07:01	ARLDFNLIRL	0.9995	0.785	5	15
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	HLA-B27:10	ARLDFNLIRLR	0.9998	0.9015	5	16

Top

Potential FusionNeoAntigen Information of ATIC-GIGYF2 in HLA II

ATIC-GIGYF2_216184454_233612325.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ATIC-GIGYF2	chr2	216184454	chr2	233612325	616	DRB1-0123	DFNLIRLRALSSGGS	8	23

Top

Fusion breakpoint peptide structures of ATIC-GIGYF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7998	RLDFNLIRLRALSS	ATIC	GIGYF2	chr2	216184454	chr2	233612325	616

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ATIC-GIGYF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7998	RLDFNLIRLRALSS	-7.15543	-7.26883
HLA-B14:02	3BVN	7998	RLDFNLIRLRALSS	-4.77435	-5.80965
HLA-B52:01	3W39	7998	RLDFNLIRLRALSS	-6.80875	-6.92215
HLA-B52:01	3W39	7998	RLDFNLIRLRALSS	-4.20386	-5.23916
HLA-A11:01	4UQ2	7998	RLDFNLIRLRALSS	-7.5194	-8.5547
HLA-A11:01	4UQ2	7998	RLDFNLIRLRALSS	-6.9601	-7.0735
HLA-A24:02	5HGA	7998	RLDFNLIRLRALSS	-7.52403	-7.63743
HLA-A24:02	5HGA	7998	RLDFNLIRLRALSS	-5.82433	-6.85963
HLA-B27:05	6PYJ	7998	RLDFNLIRLRALSS	-3.28285	-4.31815
HLA-B44:05	3DX8	7998	RLDFNLIRLRALSS	-5.91172	-6.94702
HLA-B44:05	3DX8	7998	RLDFNLIRLRALSS	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ATIC-GIGYF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ATIC-GIGYF2	chr2	216184454	chr2	233612325	10	18	NLIRLRAL	TCTTATAAGGCTCCGAGCTCTGTC
ATIC-GIGYF2	chr2	216184454	chr2	233612325	4	14	MARLDFNLIR	GGCCAGACTTGATTTCAATCTTATAAGGCT
ATIC-GIGYF2	chr2	216184454	chr2	233612325	5	14	ARLDFNLIR	CAGACTTGATTTCAATCTTATAAGGCT
ATIC-GIGYF2	chr2	216184454	chr2	233612325	5	15	ARLDFNLIRL	CAGACTTGATTTCAATCTTATAAGGCTCCG
ATIC-GIGYF2	chr2	216184454	chr2	233612325	5	16	ARLDFNLIRLR	CAGACTTGATTTCAATCTTATAAGGCTCCGAGC
ATIC-GIGYF2	chr2	216184454	chr2	233612325	6	15	RLDFNLIRL	ACTTGATTTCAATCTTATAAGGCTCCG
ATIC-GIGYF2	chr2	216184454	chr2	233612325	9	18	FNLIRLRAL	CAATCTTATAAGGCTCCGAGCTCTGTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ATIC-GIGYF2	chr2	216184454	chr2	233612325	8	23	DFNLIRLRALSSGGS	TTTCAATCTTATAAGGCTCCGAGCTCTGTCCAGTGGTGGGAGTAT

Top

Information of the samples that have these potential fusion neoantigens of ATIC-GIGYF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	ATIC-GIGYF2	chr2	216184454	ENST00000236959	chr2	233612325	ENST00000373563	TCGA-D8-A143-01A

Top

Potential target of CAR-T therapy development for ATIC-GIGYF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ATIC-GIGYF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ATIC-GIGYF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	ATIC	C0001787	Osteoporosis, Age-Related	1	CTD_human
Hgene	ATIC	C0003873	Rheumatoid Arthritis	1	CTD_human
Hgene	ATIC	C0013221	Drug toxicity	1	CTD_human
Hgene	ATIC	C0029456	Osteoporosis	1	CTD_human
Hgene	ATIC	C0029459	Osteoporosis, Senile	1	CTD_human
Hgene	ATIC	C0041755	Adverse reaction to drug	1	CTD_human
Hgene	ATIC	C0155003	Blindness, Transient	1	CTD_human
Hgene	ATIC	C0221473	Blindness, Hysterical	1	CTD_human
Hgene	ATIC	C0271215	Blindness, Legal	1	CTD_human
Hgene	ATIC	C0339730	Blindness, Acquired	1	CTD_human
Hgene	ATIC	C0376288	Amaurosis	1	CTD_human
Hgene	ATIC	C0456909	Blindness	1	CTD_human
Hgene	ATIC	C0750958	Blindness, Monocular	1	CTD_human
Hgene	ATIC	C0751406	Post-Traumatic Osteoporosis	1	CTD_human
Hgene	ATIC	C1837530	AICAR Transformylase Inosine Monophosphate Cyclohydrolase Deficiency	1	CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Hgene	ATIC	C1879328	Blindness both eyes NOS (disorder)	1	CTD_human
Hgene	ATIC	C3714756	Intellectual Disability	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)