Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:RPS6KA1-LIN28A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: RPS6KA1-LIN28A
	FusionPDB ID: 77985
	FusionGDB2.0 ID: 77985
		Hgene	Tgene
	Gene symbol	RPS6KA1	LIN28A
	Gene ID	6195	79727
	Gene name	ribosomal protein S6 kinase A1	lin-28 homolog A
	Synonyms	HU-1\|MAPKAPK1\|MAPKAPK1A\|RSK\|RSK1\|p90Rsk	CSDD1\|LIN-28\|LIN28\|ZCCHC1\|lin-28A
	Cytomap	1p36.11	1p36.11
	Type of gene	protein-coding	protein-coding
	Description	ribosomal protein S6 kinase alpha-190 kDa ribosomal protein S6 kinase 1MAP kinase-activated protein kinase 1aMAPK-activated protein kinase 1aMAPKAP kinase 1aMAPKAPK-1aRSK-1S6K-alpha 1dJ590P13.1 (ribosomal protein S6 kinase, 90kD, polypeptide 1)p9	protein lin-28 homolog ARNA-binding protein LIN-28zinc finger CCHC domain-containing protein 1zinc finger, CCHC domain containing 1
	Modification date	20200327	20200322
	UniProtAcc	.	Q9H9Z2 Main function of 5'-partner protein: FUNCTION: RNA-binding protein that inhibits processing of pre-let-7 miRNAs and regulates translation of mRNAs that control developmental timing, pluripotency and metabolism (PubMed:21247876). Seems to recognize a common structural G-quartet (G4) feature in its miRNA and mRNA targets (Probable). 'Translational enhancer' that drives specific mRNAs to polysomes and increases the efficiency of protein synthesis. Its association with the translational machinery and target mRNAs results in an increased number of initiation events per molecule of mRNA and, indirectly, in mRNA stabilization. Binds IGF2 mRNA, MYOD1 mRNA, ARBP/36B4 ribosomal protein mRNA and its own mRNA. Essential for skeletal muscle differentiation program through the translational up-regulation of IGF2 expression. Suppressor of microRNA (miRNA) biogenesis, including that of let-7, miR107, miR-143 and miR-200c. Specifically binds the miRNA precursors (pre-miRNAs), recognizing an 5'-GGAG-3' motif found in pre-miRNA terminal loop, and recruits TUT4 AND tut7 uridylyltransferaseS. This results in the terminal uridylation of target pre-miRNAs. Uridylated pre-miRNAs fail to be processed by Dicer and undergo degradation. The repression of let-7 expression is required for normal development and contributes to maintain the pluripotent state by preventing let-7-mediated differentiation of embryonic stem cells (PubMed:18951094, PubMed:19703396, PubMed:22118463, PubMed:22898984). Localized to the periendoplasmic reticulum area, binds to a large number of spliced mRNAs and inhibits the translation of mRNAs destined for the ER, reducing the synthesis of transmembrane proteins, ER or Golgi lumen proteins, and secretory proteins. Binds to and enhances the translation of mRNAs for several metabolic enzymes, such as PFKP, PDHA1 or SDHA, increasing glycolysis and oxidative phosphorylation. Which, with the let-7 repression may enhance tissue repair in adult tissue (By similarity). {ECO:0000250\|UniProtKB:Q8K3Y3, ECO:0000269\|PubMed:18951094, ECO:0000269\|PubMed:19703396, ECO:0000269\|PubMed:21247876, ECO:0000269\|PubMed:22118463, ECO:0000269\|PubMed:22898984, ECO:0000305}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000374162, ENST00000374166, ENST00000374168, ENST00000526792, ENST00000530003, ENST00000531382, ENST00000488985,	ENST00000254231, ENST00000326279,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 4 X 3=36	2 X 2 X 2=8
	# samples	5	2
	** MAII score	log2(5/36*10)=0.473931188332412 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(2/8*10)=1.32192809488736
Fusion gene context	PubMed: RPS6KA1 [Title/Abstract] AND LIN28A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: RPS6KA1 [Title/Abstract] AND LIN28A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	RPS6KA1(26885428)-LIN28A(26751794), # samples:3
Anticipated loss of major functional domain due to fusion event.	RPS6KA1-LIN28A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RPS6KA1-LIN28A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. RPS6KA1-LIN28A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. RPS6KA1-LIN28A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RPS6KA1	GO:0043154	negative regulation of cysteine-type endopeptidase activity involved in apoptotic process	18402937

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:26885428/chr1:26751794)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across RPS6KA1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LIN28A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000374168	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	5035	1369	154	1770	538
ENST00000374168	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4524	1369	154	1770	538
ENST00000374166	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	4991	1325	143	1726	527
ENST00000374166	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4480	1325	143	1726	527
ENST00000526792	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	5039	1373	101	1774	557
ENST00000526792	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4528	1373	101	1774	557
ENST00000374162	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	4812	1146	0	1547	515
ENST00000374162	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4301	1146	0	1547	515
ENST00000530003	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	4883	1217	26	1618	530
ENST00000530003	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4372	1217	26	1618	530
ENST00000531382	RPS6KA1	chr1	26885428	+	ENST00000326279	LIN28A	chr1	26751794	+	4957	1291	13	1692	559
ENST00000531382	RPS6KA1	chr1	26885428	+	ENST00000254231	LIN28A	chr1	26751794	+	4446	1291	13	1692	559

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000374168	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000422253	0.9995777
ENST00000374168	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000346396	0.9996536
ENST00000374166	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000240937	0.999759
ENST00000374166	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000195793	0.9998042
ENST00000526792	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.001805792	0.9981943
ENST00000526792	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.001558367	0.99844164
ENST00000374162	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.001664854	0.9983352
ENST00000374162	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.001490138	0.9985098
ENST00000530003	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000682566	0.9993174
ENST00000530003	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000553686	0.99944633
ENST00000531382	ENST00000326279	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000822904	0.99917704
ENST00000531382	ENST00000254231	RPS6KA1	chr1	26885428	+	LIN28A	chr1	26751794	+	0.000641825	0.99935824

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for RPS6KA1-LIN28A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1146	381	KPRAPQAPLHSVVQSKLHMEGFRSLK
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1217	396	KPRAPQAPLHSVVQSKLHMEGFRSLK
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1291	425	KPRAPQAPLHSVVQSKLHMEGFRSLK
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1325	393	KPRAPQAPLHSVVQSKLHMEGFRSLK
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1369	404	KPRAPQAPLHSVVQSKLHMEGFRSLK
RPS6KA1	chr1	26885428	LIN28A	chr1	26751794	1373	423	KPRAPQAPLHSVVQSKLHMEGFRSLK

Top

Potential FusionNeoAntigen Information of RPS6KA1-LIN28A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

RPS6KA1-LIN28A_26885428_26751794.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:01	LHSVVQSKL	0.9969	0.9634	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:06	LHSVVQSKL	0.9951	0.7763	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B38:02	LHSVVQSKL	0.991	0.9801	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B38:01	LHSVVQSKL	0.9907	0.9725	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B14:01	LHSVVQSKL	0.9893	0.7453	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B14:02	LHSVVQSKL	0.9893	0.7453	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:10	LHSVVQSKL	0.985	0.6529	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:18	LHSVVQSKL	0.8847	0.7239	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:37	LHSVVQSKL	0.8821	0.663	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B07:10	LHSVVQSKL	0.003	0.6006	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:09	LHSVVQSKL	0.9987	0.712	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:08	SVVQSKLHM	0.9961	0.9178	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:12	LHSVVQSKL	0.9957	0.9666	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:05	LHSVVQSKL	0.9909	0.9558	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C15:04	SVVQSKLHM	0.9868	0.868	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:07	SVVQSKLHM	0.9837	0.9438	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C15:06	SVVQSKLHM	0.9738	0.8953	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C07:29	LHSVVQSKL	0.816	0.9344	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C07:13	LHSVVQSKL	0.7898	0.8557	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B14:03	LHSVVQSKL	0.1936	0.7923	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B07:12	APLHSVVQSKL	0.9953	0.6834	6	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B42:01	APLHSVVQSKL	0.8737	0.8136	6	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:02	LHSVVQSKL	0.9967	0.9736	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:31	LHSVVQSKL	0.9966	0.9638	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:03	SVVQSKLHM	0.9954	0.9873	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:04	SVVQSKLHM	0.9954	0.9873	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:02	SVVQSKLHM	0.991	0.957	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B38:05	LHSVVQSKL	0.9907	0.9725	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C15:09	SVVQSKLHM	0.9868	0.868	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:05	SVVQSKLHM	0.9847	0.9217	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:09	LHSVVQSKL	0.9508	0.6453	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C03:06	SVVQSKLHM	0.8113	0.984	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B39:11	LHSVVQSKL	0.5883	0.8331	8	17
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C02:02	SVVQSKLHM	0.5016	0.9729	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-C02:10	SVVQSKLHM	0.5016	0.9729	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:30	SVVQSKLHM	0.3578	0.7355	10	19
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:24	VQSKLHMEGF	0.9983	0.874	12	22
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	1146	HLA-B15:35	VQSKLHMEGF	0.9916	0.8336	12	22

Top

Potential FusionNeoAntigen Information of RPS6KA1-LIN28A in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of RPS6KA1-LIN28A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
489	APLHSVVQSKLHME	RPS6KA1	LIN28A	chr1	26885428	chr1	26751794	1146

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of RPS6KA1-LIN28A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	489	APLHSVVQSKLHME	-7.15543	-7.26883
HLA-B14:02	3BVN	489	APLHSVVQSKLHME	-4.77435	-5.80965
HLA-B52:01	3W39	489	APLHSVVQSKLHME	-6.80875	-6.92215
HLA-B52:01	3W39	489	APLHSVVQSKLHME	-4.20386	-5.23916
HLA-A11:01	4UQ2	489	APLHSVVQSKLHME	-7.5194	-8.5547
HLA-A11:01	4UQ2	489	APLHSVVQSKLHME	-6.9601	-7.0735
HLA-A24:02	5HGA	489	APLHSVVQSKLHME	-7.52403	-7.63743
HLA-A24:02	5HGA	489	APLHSVVQSKLHME	-5.82433	-6.85963
HLA-B27:05	6PYJ	489	APLHSVVQSKLHME	-3.28285	-4.31815
HLA-B44:05	3DX8	489	APLHSVVQSKLHME	-5.91172	-6.94702
HLA-B44:05	3DX8	489	APLHSVVQSKLHME	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of RPS6KA1-LIN28A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	10	19	SVVQSKLHM	GTGGTACAGAGTAAGCTGCACATGGAA
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	12	22	VQSKLHMEGF	CAGAGTAAGCTGCACATGGAAGGGTTCCGG
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	6	17	APLHSVVQSKL	CCCCTGCACTCGGTGGTACAGAGTAAGCTGCAC
RPS6KA1-LIN28A	chr1	26885428	chr1	26751794	8	17	LHSVVQSKL	CACTCGGTGGTACAGAGTAAGCTGCAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of RPS6KA1-LIN28A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	RPS6KA1-LIN28A	chr1	26885428	ENST00000374162	chr1	26751794	ENST00000254231	TCGA-55-8085-01A

Top

Potential target of CAR-T therapy development for RPS6KA1-LIN28A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to RPS6KA1-LIN28A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to RPS6KA1-LIN28A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)