Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ATP5C1-MGEA5

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ATP5C1-MGEA5
	FusionPDB ID: 7949
	FusionGDB2.0 ID: 7949
		Hgene	Tgene
	Gene symbol	ATP5C1	MGEA5
	Gene ID	509	10724
	Gene name	ATP synthase F1 subunit gamma	O-GlcNAcase
	Synonyms	ATP5C\|ATP5C1\|ATP5CL1	MEA5\|MGEA5\|NCOAT
	Cytomap	10p14	10q24.32
	Type of gene	protein-coding	protein-coding
	Description	ATP synthase subunit gamma, mitochondrialATP synthase gamma chain, mitochondrialATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1F-ATPase gamma subunitmitochondrial ATP synthase, gamma subunit 1	protein O-GlcNAcaseN-acetyl-beta-D-glucosaminidaseN-acetyl-beta-glucosaminidasebeta-N-acetylglucosaminidasebeta-N-acetylhexosaminidasebeta-hexosaminidasebifunctional protein NCOAThyaluronidase in meningiomameningioma expressed antigen 5 (hyaluroni
	Modification date	20200320	20200329
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000493053, ENST00000335698, ENST00000356708, ENST00000541227,	ENST00000361464, ENST00000439817, ENST00000357797, ENST00000370094, ENST00000419011, ENST00000482611,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 8 X 7=560	9 X 10 X 5=450
	# samples	11	12
	** MAII score	log2(11/560*10)=-2.34792330342031 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/450*10)=-1.90689059560852 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ATP5C1 [Title/Abstract] AND MGEA5 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ATP5C1 [Title/Abstract] AND MGEA5 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ATP5C1(7841157)-MGEA5(103572884), # samples:1
Anticipated loss of major functional domain due to fusion event.	ATP5C1-MGEA5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ATP5C1-MGEA5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ATP5C1	GO:0042776	mitochondrial ATP synthesis coupled proton transport	12110673
Tgene	MGEA5	GO:0006044	N-acetylglucosamine metabolic process	11148210
Tgene	MGEA5	GO:0006517	protein deglycosylation	11148210

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:7841157/chr10:103572884)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ATP5C1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MGEA5 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000356708	ATP5C1	chr10	7841157	+	ENST00000439817	MGEA5	chr10	103572884	-	4856	507	79	2847	922
ENST00000356708	ATP5C1	chr10	7841157	+	ENST00000361464	MGEA5	chr10	103572884	-	5006	507	79	3006	975
ENST00000541227	ATP5C1	chr10	7841157	+	ENST00000439817	MGEA5	chr10	103572884	-	4773	424	20	2764	914
ENST00000541227	ATP5C1	chr10	7841157	+	ENST00000361464	MGEA5	chr10	103572884	-	4923	424	20	2923	967
ENST00000335698	ATP5C1	chr10	7841157	+	ENST00000439817	MGEA5	chr10	103572884	-	4808	459	31	2799	922
ENST00000335698	ATP5C1	chr10	7841157	+	ENST00000361464	MGEA5	chr10	103572884	-	4958	459	31	2958	975

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000356708	ENST00000439817	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.00029673	0.9997032
ENST00000356708	ENST00000361464	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.000182183	0.9998178
ENST00000541227	ENST00000439817	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.000653205	0.9993468
ENST00000541227	ENST00000361464	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.000408864	0.9995912
ENST00000335698	ENST00000439817	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.000297135	0.9997029
ENST00000335698	ENST00000361464	ATP5C1	chr10	7841157	+	MGEA5	chr10	103572884	-	0.00018013	0.99981993

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ATP5C1-MGEA5

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ATP5C1	chr10	7841157	MGEA5	chr10	103572884	424	134	LVGIGDKIRGILYRLQKWELNTYLYA
ATP5C1	chr10	7841157	MGEA5	chr10	103572884	459	142	LVGIGDKIRGILYRLQKWELNTYLYA
ATP5C1	chr10	7841157	MGEA5	chr10	103572884	507	142	LVGIGDKIRGILYRLQKWELNTYLYA

Top

Potential FusionNeoAntigen Information of ATP5C1-MGEA5 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ATP5C1-MGEA5_7841157_103572884.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:07	YRLQKWEL	0.9999	0.5813	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B39:24	YRLQKWEL	0.9992	0.7188	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B14:02	YRLQKWEL	0.9986	0.9479	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B14:01	YRLQKWEL	0.9986	0.9479	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B39:01	YRLQKWEL	0.9978	0.9064	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B08:01	YRLQKWEL	0.9904	0.7631	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:37	YRLQKWEL	0.9476	0.7352	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:08	KIRGILYRL	0.9917	0.58	6	15
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:08	RGILYRLQK	0.9869	0.5672	8	17
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A24:25	LYRLQKWEL	0.9855	0.6172	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A24:20	LYRLQKWEL	0.9821	0.6122	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A24:15	LYRLQKWEL	0.9815	0.6302	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A24:31	LYRLQKWEL	0.9752	0.6066	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B57:01	GILYRLQKW	0.9619	0.9796	9	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A32:13	GILYRLQKW	0.9189	0.9527	9	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A32:13	KIRGILYRL	0.9097	0.8518	6	15
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B08:01	LYRLQKWEL	0.8918	0.684	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B57:01	RGILYRLQKW	0.9995	0.9784	8	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:02	YRLQKWELNTY	1	0.6163	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:05	YRLQKWELNTY	1	0.7764	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:04	YRLQKWELNTY	1	0.7522	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:08	KIRGILYRLQK	0.9962	0.6899	6	17
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:01	YRLQKWELNTY	0.9916	0.8529	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:25	YRLQKWELNTY	0.9851	0.8744	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:18	YRLQKWELNTY	0.9347	0.7286	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:05	YRLQKWEL	0.9998	0.9392	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:19	YRLQKWEL	0.9997	0.8001	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:46	YRLQKWEL	0.9997	0.9064	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:27	YRLQKWEL	0.9997	0.9569	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:95	YRLQKWEL	0.9997	0.7999	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:67	YRLQKWEL	0.9996	0.9487	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:80	YRLQKWEL	0.9996	0.9487	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:10	YRLQKWEL	0.9995	0.9571	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:29	YRLQKWEL	0.9995	0.9391	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:13	YRLQKWEL	0.9993	0.9316	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B39:09	YRLQKWEL	0.9985	0.8093	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B39:12	YRLQKWEL	0.9972	0.9115	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C12:16	YRLQKWEL	0.972	0.9728	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B14:03	YRLQKWEL	0.8641	0.9387	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A24:02	LYRLQKWEL	0.9821	0.6122	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:05	LYRLQKWEL	0.3976	0.9753	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:67	LYRLQKWEL	0.3052	0.9765	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:80	LYRLQKWEL	0.3052	0.9765	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:10	LYRLQKWEL	0.2943	0.9811	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:03	YRLQKWELNTY	0.9994	0.7839	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:67	YRLQKWELNTY	0.998	0.9257	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:80	YRLQKWELNTY	0.998	0.9257	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:46	YRLQKWELNTY	0.998	0.851	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:10	YRLQKWELNTY	0.9972	0.9346	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:07	YRLQKWELNTY	0.9967	0.7089	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:05	YRLQKWELNTY	0.9667	0.9246	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:09	YRLQKWEL	0.9999	0.8498	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:08	YRLQKWEL	0.9999	0.7899	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:06	YRLQKWEL	0.9999	0.853	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:01	YRLQKWEL	0.9998	0.7539	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:17	YRLQKWEL	0.9997	0.964	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:02	YRLQKWEL	0.9996	0.9487	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:04	YRLQKWEL	0.9991	0.9407	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:22	YRLQKWEL	0.9989	0.8003	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B39:31	YRLQKWEL	0.9975	0.9082	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C06:08	YRLQKWEL	0.9946	0.9948	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:24	ILYRLQKW	0.9906	0.9381	10	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B08:18	YRLQKWEL	0.9904	0.7631	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C06:17	YRLQKWEL	0.9709	0.9956	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C06:02	YRLQKWEL	0.9709	0.9956	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C06:06	YRLQKWEL	0.933	0.992	12	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:01	KIRGILYRL	0.9923	0.7744	6	15
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A32:01	KIRGILYRL	0.9881	0.8244	6	15
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:01	RGILYRLQK	0.9878	0.6814	8	17
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A32:01	GILYRLQKW	0.9835	0.9666	9	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B57:10	GILYRLQKW	0.9619	0.9796	9	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B08:18	LYRLQKWEL	0.8918	0.684	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:02	LYRLQKWEL	0.3052	0.9765	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C14:02	LYRLQKWEL	0.1804	0.9796	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C14:03	LYRLQKWEL	0.1804	0.9796	11	20
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B57:10	RGILYRLQKW	0.9995	0.9784	8	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B58:06	RGILYRLQKW	0.9927	0.8508	8	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A32:01	RGILYRLQKW	0.9768	0.9444	8	18
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:10	YRLQKWELNTY	1	0.8543	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B27:08	YRLQKWELNTY	1	0.7079	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:02	YRLQKWELNTY	0.998	0.9257	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:35	YRLQKWELNTY	0.9966	0.8565	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-C07:22	YRLQKWELNTY	0.9962	0.727	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-A30:01	KIRGILYRLQK	0.9958	0.8279	6	17
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:12	YRLQKWELNTY	0.9919	0.8886	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:135	YRLQKWELNTY	0.9918	0.8689	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:34	YRLQKWELNTY	0.9916	0.8529	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:125	YRLQKWELNTY	0.9916	0.8529	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:33	YRLQKWELNTY	0.9916	0.8529	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:27	YRLQKWELNTY	0.9911	0.8535	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:50	YRLQKWELNTY	0.9893	0.9142	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:54	YRLQKWELNTY	0.9872	0.8243	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:39	YRLQKWELNTY	0.987	0.8057	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:24	YRLQKWELNTY	0.9842	0.8478	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:68	YRLQKWELNTY	0.9804	0.6537	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:53	YRLQKWELNTY	0.9777	0.8482	12	23
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	459	HLA-B15:20	YRLQKWELNTY	0.9647	0.9584	12	23

Top

Potential FusionNeoAntigen Information of ATP5C1-MGEA5 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ATP5C1-MGEA5

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4312	KIRGILYRLQKWEL	ATP5C1	MGEA5	chr10	7841157	chr10	103572884	459

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ATP5C1-MGEA5

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4312	KIRGILYRLQKWEL	-7.9962	-8.1096
HLA-B14:02	3BVN	4312	KIRGILYRLQKWEL	-5.70842	-6.74372
HLA-B52:01	3W39	4312	KIRGILYRLQKWEL	-6.83737	-6.95077
HLA-B52:01	3W39	4312	KIRGILYRLQKWEL	-4.4836	-5.5189
HLA-A11:01	4UQ2	4312	KIRGILYRLQKWEL	-10.0067	-10.1201
HLA-A11:01	4UQ2	4312	KIRGILYRLQKWEL	-9.03915	-10.0745
HLA-A24:02	5HGA	4312	KIRGILYRLQKWEL	-6.56204	-6.67544
HLA-A24:02	5HGA	4312	KIRGILYRLQKWEL	-5.42271	-6.45801
HLA-B44:05	3DX8	4312	KIRGILYRLQKWEL	-7.85648	-8.89178
HLA-B44:05	3DX8	4312	KIRGILYRLQKWEL	-5.3978	-5.5112
HLA-A02:01	6TDR	4312	KIRGILYRLQKWEL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ATP5C1-MGEA5

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	10	18	ILYRLQKW	ACTTTATAGGCTCCAGAAATGGGA
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	11	20	LYRLQKWEL	TTATAGGCTCCAGAAATGGGAATTAAA
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	12	20	YRLQKWEL	TAGGCTCCAGAAATGGGAATTAAA
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	12	23	YRLQKWELNTY	TAGGCTCCAGAAATGGGAATTAAATACATACTT
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	6	15	KIRGILYRL	AATCAGAGGCATACTTTATAGGCTCCA
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	6	17	KIRGILYRLQK	AATCAGAGGCATACTTTATAGGCTCCAGAAATG
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	8	17	RGILYRLQK	AGGCATACTTTATAGGCTCCAGAAATG
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	8	18	RGILYRLQKW	AGGCATACTTTATAGGCTCCAGAAATGGGA
ATP5C1-MGEA5	chr10	7841157	chr10	103572884	9	18	GILYRLQKW	CATACTTTATAGGCTCCAGAAATGGGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ATP5C1-MGEA5

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
HNSC	ATP5C1-MGEA5	chr10	7841157	ENST00000335698	chr10	103572884	ENST00000361464	TCGA-CQ-A4CA

Top

Potential target of CAR-T therapy development for ATP5C1-MGEA5

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ATP5C1-MGEA5

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ATP5C1-MGEA5

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)