Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SERBP1-CTSA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SERBP1-CTSA
	FusionPDB ID: 80583
	FusionGDB2.0 ID: 80583
		Hgene	Tgene
	Gene symbol	SERBP1	CTSA
	Gene ID	26135	5476
	Gene name	SERPINE1 mRNA binding protein 1	cathepsin A
	Synonyms	CGI-55\|CHD3IP\|HABP4L\|PAI-RBP1\|PAIRBP1	GLB2\|GSL\|NGBE\|PPCA\|PPGB
	Cytomap	1p31.3	20q13.12
	Type of gene	protein-coding	protein-coding
	Description	plasminogen activator inhibitor 1 RNA-binding proteinPAI-1 mRNA binding proteinPAI1 RNA-binding protein 1chromodomain helicase DNA binding protein 3 interacting protein	lysosomal protective proteinbeta-galactosidase 2beta-galactosidase protective proteincarboxypeptidase Ccarboxypeptidase Y-like kininasecarboxypeptidase-Ldeamidaselysosomal carboxypeptidase Aprotective protein cathepsin Aurinary kininase
	Modification date	20200313	20200313
	UniProtAcc	.	P10619 Main function of 5'-partner protein: FUNCTION: Protective protein appears to be essential for both the activity of beta-galactosidase and neuraminidase, it associates with these enzymes and exerts a protective function necessary for their stability and activity. This protein is also a carboxypeptidase and can deamidate tachykinins. {ECO:0000269\|PubMed:1907282}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000361219, ENST00000370990, ENST00000370994, ENST00000370995, ENST00000484880,	ENST00000191018, ENST00000354880, ENST00000372459, ENST00000372484,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 3=75	7 X 6 X 4=168
	# samples	5	7
	** MAII score	log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SERBP1 [Title/Abstract] AND CTSA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SERBP1 [Title/Abstract] AND CTSA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SERBP1(67885691)-CTSA(44521858), # samples:1
Anticipated loss of major functional domain due to fusion event.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SERBP1	GO:0030578	PML body organization	28695742
Tgene	CTSA	GO:0006508	proteolysis	12505983

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:67885691/chr20:44521858)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SERBP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CTSA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000370994	SERBP1	chr1	67885691	-	ENST00000372484	CTSA	chr20	44521858	+	2261	1048	115	1890	591
ENST00000370994	SERBP1	chr1	67885691	-	ENST00000354880	CTSA	chr20	44521858	+	2261	1048	115	1890	591
ENST00000370994	SERBP1	chr1	67885691	-	ENST00000191018	CTSA	chr20	44521858	+	2261	1048	115	1890	591
ENST00000370994	SERBP1	chr1	67885691	-	ENST00000372459	CTSA	chr20	44521858	+	2227	1048	115	1890	591
ENST00000370995	SERBP1	chr1	67885691	-	ENST00000372484	CTSA	chr20	44521858	+	2295	1082	86	1924	612
ENST00000370995	SERBP1	chr1	67885691	-	ENST00000354880	CTSA	chr20	44521858	+	2295	1082	86	1924	612
ENST00000370995	SERBP1	chr1	67885691	-	ENST00000191018	CTSA	chr20	44521858	+	2295	1082	86	1924	612
ENST00000370995	SERBP1	chr1	67885691	-	ENST00000372459	CTSA	chr20	44521858	+	2261	1082	86	1924	612
ENST00000361219	SERBP1	chr1	67885691	-	ENST00000372484	CTSA	chr20	44521858	+	2263	1050	99	1892	597
ENST00000361219	SERBP1	chr1	67885691	-	ENST00000354880	CTSA	chr20	44521858	+	2263	1050	99	1892	597
ENST00000361219	SERBP1	chr1	67885691	-	ENST00000191018	CTSA	chr20	44521858	+	2263	1050	99	1892	597
ENST00000361219	SERBP1	chr1	67885691	-	ENST00000372459	CTSA	chr20	44521858	+	2229	1050	99	1892	597
ENST00000370990	SERBP1	chr1	67885691	-	ENST00000372484	CTSA	chr20	44521858	+	2263	1050	72	1892	606
ENST00000370990	SERBP1	chr1	67885691	-	ENST00000354880	CTSA	chr20	44521858	+	2263	1050	72	1892	606
ENST00000370990	SERBP1	chr1	67885691	-	ENST00000191018	CTSA	chr20	44521858	+	2263	1050	72	1892	606
ENST00000370990	SERBP1	chr1	67885691	-	ENST00000372459	CTSA	chr20	44521858	+	2229	1050	72	1892	606

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000370994	ENST00000372484	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006549318	0.99345064
ENST00000370994	ENST00000354880	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006549318	0.99345064
ENST00000370994	ENST00000191018	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006549318	0.99345064
ENST00000370994	ENST00000372459	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.007353079	0.99264693
ENST00000370995	ENST00000372484	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.004365438	0.9956345
ENST00000370995	ENST00000354880	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.004365438	0.9956345
ENST00000370995	ENST00000191018	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.004365438	0.9956345
ENST00000370995	ENST00000372459	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.005017802	0.9949822
ENST00000361219	ENST00000372484	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006192911	0.993807
ENST00000361219	ENST00000354880	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006192911	0.993807
ENST00000361219	ENST00000191018	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.006192911	0.993807
ENST00000361219	ENST00000372459	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.007102136	0.99289787
ENST00000370990	ENST00000372484	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.00449834	0.9955017
ENST00000370990	ENST00000354880	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.00449834	0.9955017
ENST00000370990	ENST00000191018	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.00449834	0.9955017
ENST00000370990	ENST00000372459	SERBP1	chr1	67885691	-	CTSA	chr20	44521858	+	0.005197542	0.9948025

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SERBP1-CTSA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SERBP1	chr1	67885691	CTSA	chr20	44521858	1048	311	KKGFVLHKSKSEEGLAVGNGLSSYEQ
SERBP1	chr1	67885691	CTSA	chr20	44521858	1050	317	KKGFVLHKSKSEEGLAVGNGLSSYEQ
SERBP1	chr1	67885691	CTSA	chr20	44521858	1050	326	KKGFVLHKSKSEEGLAVGNGLSSYEQ
SERBP1	chr1	67885691	CTSA	chr20	44521858	1082	332	KKGFVLHKSKSEEGLAVGNGLSSYEQ

Top

Potential FusionNeoAntigen Information of SERBP1-CTSA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SERBP1-CTSA_67885691_44521858.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B39:01	SKSEEGLAV	0.9817	0.9655	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B38:02	HKSKSEEGL	0.6924	0.9803	6	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B15:10	SKSEEGLAV	0.4662	0.7318	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B38:01	LHKSKSEEGL	0.6776	0.974	5	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B39:05	SKSEEGLAV	0.9495	0.9608	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B39:08	SEEGLAVGNGL	0.9963	0.8658	10	21
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B39:02	SKSEEGLAV	0.9861	0.9626	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B39:11	SKSEEGLAV	0.592	0.7877	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B15:09	SKSEEGLAV	0.5461	0.95	8	17
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B38:05	LHKSKSEEGL	0.6776	0.974	5	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B40:04	SEEGLAVGNGL	0.9991	0.7111	10	21
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	HLA-B41:03	SEEGLAVGNGL	0.9794	0.5469	10	21

Top

Potential FusionNeoAntigen Information of SERBP1-CTSA in HLA II

SERBP1-CTSA_67885691_44521858.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0706	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0803	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0814	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0815	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0823	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0827	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0830	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0832	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0833	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0834	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0835	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0836	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0837	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0838	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0903	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-0908	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1114	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1120	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1130	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1168	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1182	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1186	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1302	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1313	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1316	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1323	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1329	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1331	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1334	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1336	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1338	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1338	KGFVLHKSKSEEGLA	1	16
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1339	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1341	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1365	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1365	KGFVLHKSKSEEGLA	1	16
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1367	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1367	KGFVLHKSKSEEGLA	1	16
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1373	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1374	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1375	KGFVLHKSKSEEGLA	1	16
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1375	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1396	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1397	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1399	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1424	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1463	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB1-1485	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB5-0103	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB5-0111	KKGFVLHKSKSEEGL	0	15
SERBP1-CTSA	chr1	67885691	chr20	44521858	1050	DRB5-0203	KKGFVLHKSKSEEGL	0	15

Top

Fusion breakpoint peptide structures of SERBP1-CTSA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3388	HKSKSEEGLAVGNG	SERBP1	CTSA	chr1	67885691	chr20	44521858	1050

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SERBP1-CTSA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3388	HKSKSEEGLAVGNG	-7.9962	-8.1096
HLA-B14:02	3BVN	3388	HKSKSEEGLAVGNG	-5.70842	-6.74372
HLA-B52:01	3W39	3388	HKSKSEEGLAVGNG	-6.83737	-6.95077
HLA-B52:01	3W39	3388	HKSKSEEGLAVGNG	-4.4836	-5.5189
HLA-A11:01	4UQ2	3388	HKSKSEEGLAVGNG	-10.0067	-10.1201
HLA-A11:01	4UQ2	3388	HKSKSEEGLAVGNG	-9.03915	-10.0745
HLA-A24:02	5HGA	3388	HKSKSEEGLAVGNG	-6.56204	-6.67544
HLA-A24:02	5HGA	3388	HKSKSEEGLAVGNG	-5.42271	-6.45801
HLA-B44:05	3DX8	3388	HKSKSEEGLAVGNG	-7.85648	-8.89178
HLA-B44:05	3DX8	3388	HKSKSEEGLAVGNG	-5.3978	-5.5112
HLA-A02:01	6TDR	3388	HKSKSEEGLAVGNG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SERBP1-CTSA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SERBP1-CTSA	chr1	67885691	chr20	44521858	10	21	SEEGLAVGNGL	AGTGAAGAGGGGCTGGCTGTGGGCAATGGACTC
SERBP1-CTSA	chr1	67885691	chr20	44521858	5	15	LHKSKSEEGL	CTTCATAAATCAAAGAGTGAAGAGGGGCTG
SERBP1-CTSA	chr1	67885691	chr20	44521858	6	15	HKSKSEEGL	CATAAATCAAAGAGTGAAGAGGGGCTG
SERBP1-CTSA	chr1	67885691	chr20	44521858	8	17	SKSEEGLAV	TCAAAGAGTGAAGAGGGGCTGGCTGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SERBP1-CTSA	chr1	67885691	chr20	44521858	0	15	KKGFVLHKSKSEEGL	AAGAAGGGATTTGTTCTTCATAAATCAAAGAGTGAAGAGGGGCTG
SERBP1-CTSA	chr1	67885691	chr20	44521858	1	16	KGFVLHKSKSEEGLA	AAGGGATTTGTTCTTCATAAATCAAAGAGTGAAGAGGGGCTGGCT

Top

Information of the samples that have these potential fusion neoantigens of SERBP1-CTSA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SERBP1-CTSA	chr1	67885691	ENST00000361219	chr20	44521858	ENST00000191018	TCGA-VQ-A94R

Top

Potential target of CAR-T therapy development for SERBP1-CTSA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SERBP1-CTSA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SERBP1-CTSA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)