Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SETDB1-PKP4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SETDB1-PKP4
	FusionPDB ID: 80943
	FusionGDB2.0 ID: 80943
		Hgene	Tgene
	Gene symbol	SETDB1	PKP4
	Gene ID	9869	8502
	Gene name	SET domain bifurcated histone lysine methyltransferase 1	plakophilin 4
	Synonyms	ESET\|H3-K9-HMTase4\|KG1T\|KMT1E\|TDRD21	p0071
	Cytomap	1q21.3	2q24.1
	Type of gene	protein-coding	protein-coding
	Description	histone-lysine N-methyltransferase SETDB1ERG-associated protein with a SET domain, ESETSET domain bifurcated 1histone H3-K9 methyltransferase 4histone-lysine N-methyltransferase, H3lysine-9 specific 4lysine N-methyltransferase 1Etudor domain contain	plakophilin-4catenin 4
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000271640, ENST00000368962, ENST00000368963, ENST00000368969, ENST00000459773,	ENST00000495123, ENST00000389757, ENST00000389759,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 7 X 6=336	15 X 19 X 6=1710
	# samples	8	22
	** MAII score	log2(8/336*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/1710*10)=-2.9584208962486 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SETDB1 [Title/Abstract] AND PKP4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SETDB1 [Title/Abstract] AND PKP4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SETDB1(150915164)-PKP4(159477502), # samples:2
Anticipated loss of major functional domain due to fusion event.	SETDB1-PKP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SETDB1-PKP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SETDB1-PKP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SETDB1-PKP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PKP4	GO:0043547	positive regulation of GTPase activity	17115030

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:150915164/chr2:159477502)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SETDB1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PKP4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000271640	SETDB1	chr1	150915164	+	ENST00000389757	PKP4	chr2	159477502	+	6235	863	190	4032	1280
ENST00000271640	SETDB1	chr1	150915164	+	ENST00000389759	PKP4	chr2	159477502	+	4914	863	190	4161	1323
ENST00000368962	SETDB1	chr1	150915164	+	ENST00000389757	PKP4	chr2	159477502	+	6171	799	126	3968	1280
ENST00000368962	SETDB1	chr1	150915164	+	ENST00000389759	PKP4	chr2	159477502	+	4850	799	126	4097	1323
ENST00000368969	SETDB1	chr1	150915164	+	ENST00000389757	PKP4	chr2	159477502	+	6162	790	117	3959	1280
ENST00000368969	SETDB1	chr1	150915164	+	ENST00000389759	PKP4	chr2	159477502	+	4841	790	117	4088	1323
ENST00000368963	SETDB1	chr1	150915164	+	ENST00000389757	PKP4	chr2	159477502	+	6150	778	105	3947	1280
ENST00000368963	SETDB1	chr1	150915164	+	ENST00000389759	PKP4	chr2	159477502	+	4829	778	105	4076	1323

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000271640	ENST00000389757	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.000571443	0.9994286
ENST00000271640	ENST00000389759	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.001063906	0.9989361
ENST00000368962	ENST00000389757	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.000572488	0.99942756
ENST00000368962	ENST00000389759	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.001076306	0.9989237
ENST00000368969	ENST00000389757	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.000549756	0.99945027
ENST00000368969	ENST00000389759	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.001056391	0.9989436
ENST00000368963	ENST00000389757	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.000549103	0.99945086
ENST00000368963	ENST00000389759	SETDB1	chr1	150915164	+	PKP4	chr2	159477502	+	0.00106821	0.9989318

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SETDB1-PKP4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SETDB1	chr1	150915164	PKP4	chr2	159477502	778	224	TWHKGTLIAIQTVDVPNTGVSKPRVS
SETDB1	chr1	150915164	PKP4	chr2	159477502	790	224	TWHKGTLIAIQTVDVPNTGVSKPRVS
SETDB1	chr1	150915164	PKP4	chr2	159477502	799	224	TWHKGTLIAIQTVDVPNTGVSKPRVS
SETDB1	chr1	150915164	PKP4	chr2	159477502	863	224	TWHKGTLIAIQTVDVPNTGVSKPRVS

Top

Potential FusionNeoAntigen Information of SETDB1-PKP4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SETDB1-PKP4_150915164_159477502.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A02:21	TVDVPNTGV	0.8896	0.6188	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A02:35	TVDVPNTGV	0.869	0.5029	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C05:09	TVDVPNTGV	0.9998	0.9541	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:15	TVDVPNTGV	0.9991	0.9779	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C04:06	TVDVPNTGV	0.9919	0.9689	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A02:07	TVDVPNTGV	0.848	0.5244	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:13	TVDVPNTGV	0.8199	0.9824	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:04	TVDVPNTGV	0.8199	0.9824	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:03	TVDVPNTGV	0.5914	0.9839	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A11:01	TVDVPNTGVSK	0.9997	0.5651	11	22
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C04:03	TVDVPNTGV	0.9998	0.9271	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C05:01	TVDVPNTGV	0.9998	0.9541	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:02	TVDVPNTGV	0.9991	0.9779	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A69:01	TVDVPNTGV	0.9285	0.6203	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A02:14	TVDVPNTGV	0.8908	0.5106	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A02:06	TVDVPNTGV	0.8896	0.6188	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-C08:01	TVDVPNTGV	0.5914	0.9839	11	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A69:01	QTVDVPNTGV	0.9687	0.5578	10	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	HLA-A11:02	TVDVPNTGVSK	0.9997	0.5651	11	22

Top

Potential FusionNeoAntigen Information of SETDB1-PKP4 in HLA II

SETDB1-PKP4_150915164_159477502.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0102	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0102	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0123	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0478	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0478	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0819	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0825	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-0834	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1002	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1404	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1404	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1410	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1410	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1410	WHKGTLIAIQTVDVP	1	16
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1428	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1431	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1439	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1439	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1461	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1461	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1471	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1471	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1615	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB1-1615	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0101	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0101	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0101	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0101	TLIAIQTVDVPNTGV	5	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0103	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0103	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0103	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0103	TLIAIQTVDVPNTGV	5	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0104	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0104	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0104	TLIAIQTVDVPNTGV	5	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0104	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0106	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0106	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0106	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0106	TLIAIQTVDVPNTGV	5	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0107	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0107	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0107	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0107	TLIAIQTVDVPNTGV	5	20
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0108	GTLIAIQTVDVPNTG	4	19
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0108	KGTLIAIQTVDVPNT	3	18
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0108	HKGTLIAIQTVDVPN	2	17
SETDB1-PKP4	chr1	150915164	chr2	159477502	863	DRB4-0108	TLIAIQTVDVPNTGV	5	20

Top

Fusion breakpoint peptide structures of SETDB1-PKP4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5082	LIAIQTVDVPNTGV	SETDB1	PKP4	chr1	150915164	chr2	159477502	863

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SETDB1-PKP4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5082	LIAIQTVDVPNTGV	-7.9962	-8.1096
HLA-B14:02	3BVN	5082	LIAIQTVDVPNTGV	-5.70842	-6.74372
HLA-B52:01	3W39	5082	LIAIQTVDVPNTGV	-6.83737	-6.95077
HLA-B52:01	3W39	5082	LIAIQTVDVPNTGV	-4.4836	-5.5189
HLA-A11:01	4UQ2	5082	LIAIQTVDVPNTGV	-10.0067	-10.1201
HLA-A11:01	4UQ2	5082	LIAIQTVDVPNTGV	-9.03915	-10.0745
HLA-A24:02	5HGA	5082	LIAIQTVDVPNTGV	-6.56204	-6.67544
HLA-A24:02	5HGA	5082	LIAIQTVDVPNTGV	-5.42271	-6.45801
HLA-B44:05	3DX8	5082	LIAIQTVDVPNTGV	-7.85648	-8.89178
HLA-B44:05	3DX8	5082	LIAIQTVDVPNTGV	-5.3978	-5.5112
HLA-A02:01	6TDR	5082	LIAIQTVDVPNTGV	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SETDB1-PKP4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SETDB1-PKP4	chr1	150915164	chr2	159477502	10	20	QTVDVPNTGV	AGACAGTTGACGTGCCAAATACTGGTGTAA
SETDB1-PKP4	chr1	150915164	chr2	159477502	11	20	TVDVPNTGV	CAGTTGACGTGCCAAATACTGGTGTAA
SETDB1-PKP4	chr1	150915164	chr2	159477502	11	22	TVDVPNTGVSK	CAGTTGACGTGCCAAATACTGGTGTAAGCAAAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SETDB1-PKP4	chr1	150915164	chr2	159477502	1	16	WHKGTLIAIQTVDVP	GGCACAAAGGCACCCTTATTGCCATCCAGACAGTTGACGTGCCAA
SETDB1-PKP4	chr1	150915164	chr2	159477502	2	17	HKGTLIAIQTVDVPN	ACAAAGGCACCCTTATTGCCATCCAGACAGTTGACGTGCCAAATA
SETDB1-PKP4	chr1	150915164	chr2	159477502	3	18	KGTLIAIQTVDVPNT	AAGGCACCCTTATTGCCATCCAGACAGTTGACGTGCCAAATACTG
SETDB1-PKP4	chr1	150915164	chr2	159477502	4	19	GTLIAIQTVDVPNTG	GCACCCTTATTGCCATCCAGACAGTTGACGTGCCAAATACTGGTG
SETDB1-PKP4	chr1	150915164	chr2	159477502	5	20	TLIAIQTVDVPNTGV	CCCTTATTGCCATCCAGACAGTTGACGTGCCAAATACTGGTGTAA

Top

Information of the samples that have these potential fusion neoantigens of SETDB1-PKP4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	SETDB1-PKP4	chr1	150915164	ENST00000271640	chr2	159477502	ENST00000389757	TCGA-E2-A1LK-01A

Top

Potential target of CAR-T therapy development for SETDB1-PKP4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SETDB1-PKP4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SETDB1-PKP4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)