Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SGSM2-PTK6

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SGSM2-PTK6
	FusionPDB ID: 81357
	FusionGDB2.0 ID: 81357
		Hgene	Tgene
	Gene symbol	SGSM2	PTK6
	Gene ID	9905	5753
	Gene name	small G protein signaling modulator 2	protein tyrosine kinase 6
	Synonyms	RUTBC1	BRK
	Cytomap	17p13.3	20q13.33
	Type of gene	protein-coding	protein-coding
	Description	small G protein signaling modulator 2RUN and TBC1 domain containing 1small G protein signaling modulator 2 protein	protein-tyrosine kinase 6PTK6 protein tyrosine kinase 6breast tumor kinaseprotein-tyrosine kinase BRKtyrosine-protein kinase BRK
	Modification date	20200313	20200329
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000268989, ENST00000426855, ENST00000574563,	ENST00000217185, ENST00000542869,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 5=150	2 X 2 X 2=8
	# samples	6	2
	** MAII score	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/8*10)=1.32192809488736
Fusion gene context	PubMed: SGSM2 [Title/Abstract] AND PTK6 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SGSM2 [Title/Abstract] AND PTK6 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SGSM2(2241039)-PTK6(62165057), # samples:1
Anticipated loss of major functional domain due to fusion event.	SGSM2-PTK6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SGSM2-PTK6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SGSM2-PTK6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SGSM2-PTK6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PTK6	GO:0007260	tyrosine phosphorylation of STAT protein	16568091\|17997837
Tgene	PTK6	GO:0016477	cell migration	15572663
Tgene	PTK6	GO:0061099	negative regulation of protein tyrosine kinase activity	15539407

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:2241039/chr20:62165057)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SGSM2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PTK6 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000268989	SGSM2	chr17	2241039	+	ENST00000217185	PTK6	chr20	62165057	-	2185	234	177	1073	298
ENST00000268989	SGSM2	chr17	2241039	+	ENST00000542869	PTK6	chr20	62165057	-	1265	234	177	1073	298
ENST00000426855	SGSM2	chr17	2241039	+	ENST00000217185	PTK6	chr20	62165057	-	2183	232	175	1071	298
ENST00000426855	SGSM2	chr17	2241039	+	ENST00000542869	PTK6	chr20	62165057	-	1263	232	175	1071	298
ENST00000574563	SGSM2	chr17	2241039	+	ENST00000217185	PTK6	chr20	62165057	-	2075	124	67	963	298
ENST00000574563	SGSM2	chr17	2241039	+	ENST00000542869	PTK6	chr20	62165057	-	1155	124	67	963	298

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000268989	ENST00000217185	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.008105667	0.9918943
ENST00000268989	ENST00000542869	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.011057771	0.98894227
ENST00000426855	ENST00000217185	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.008274959	0.99172497
ENST00000426855	ENST00000542869	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.011452206	0.9885478
ENST00000574563	ENST00000217185	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.008007262	0.9919927
ENST00000574563	ENST00000542869	SGSM2	chr17	2241039	+	PTK6	chr20	62165057	-	0.010895199	0.9891048

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SGSM2-PTK6

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SGSM2	chr17	2241039	PTK6	chr20	62165057	124	19	AVKEKLLWNVKKEHEPEPLPHWDDWE
SGSM2	chr17	2241039	PTK6	chr20	62165057	232	19	AVKEKLLWNVKKEHEPEPLPHWDDWE
SGSM2	chr17	2241039	PTK6	chr20	62165057	234	19	AVKEKLLWNVKKEHEPEPLPHWDDWE

Top

Potential FusionNeoAntigen Information of SGSM2-PTK6 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SGSM2-PTK6_2241039_62165057.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B39:13	KEHEPEPL	0.9833	0.9757	11	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B45:01	KEHEPEPLP	0.994	0.8394	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:02	KEHEPEPLP	0.9924	0.5871	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B41:01	KEHEPEPLP	0.5893	0.8495	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B15:18	EHEPEPLPH	0.4145	0.7711	12	21
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:01	KEHEPEPLP	0.3572	0.6886	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B47:01	KEHEPEPLPH	0.9613	0.6727	11	21
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:03	EHEPEPLPHW	0.9542	0.9781	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B41:01	KKEHEPEPLP	0.8444	0.8694	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B45:01	KKEHEPEPLP	0.8187	0.887	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:02	KKEHEPEPLP	0.8118	0.589	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B38:01	EHEPEPLPHW	0.8093	0.9885	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B38:02	EHEPEPLPHW	0.7846	0.9914	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:01	KKEHEPEPLP	0.7692	0.7289	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:03	KEHEPEPLPHW	0.9998	0.9815	11	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B39:08	KEHEPEPL	0.9963	0.726	11	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B40:06	KEHEPEPLP	0.9967	0.7457	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B40:03	KEHEPEPLPH	0.9933	0.5302	11	21
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:08	EHEPEPLPHW	0.951	0.5494	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:10	EHEPEPLPHW	0.5728	0.7172	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:08	KEHEPEPLPHW	0.9998	0.5044	11	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:10	KEHEPEPLPHW	0.9785	0.7037	11	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B40:04	KEHEPEPL	0.9999	0.7515	11	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B41:03	KEHEPEPL	0.9908	0.5406	11	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B39:02	KEHEPEPL	0.9803	0.9756	11	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:04	KEHEPEPLP	0.3572	0.6886	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:05	KEHEPEPLP	0.3572	0.6886	11	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:13	EHEPEPLPHW	0.9542	0.9781	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:07	EHEPEPLPHW	0.9542	0.9781	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:26	EHEPEPLPHW	0.9542	0.9781	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B38:05	EHEPEPLPHW	0.8093	0.9885	12	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:04	KKEHEPEPLP	0.7692	0.7289	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B50:05	KKEHEPEPLP	0.7692	0.7289	10	20
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:07	KEHEPEPLPHW	0.9998	0.9815	11	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:26	KEHEPEPLPHW	0.9998	0.9815	11	22
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	HLA-B44:13	KEHEPEPLPHW	0.9998	0.9815	11	22

Top

Potential FusionNeoAntigen Information of SGSM2-PTK6 in HLA II

SGSM2-PTK6_2241039_62165057.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0801	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0803	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0805	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0805	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0806	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0806	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0808	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0810	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0810	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0811	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0812	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0812	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0814	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0816	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0818	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0822	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0822	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0823	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0826	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0827	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0829	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0829	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0833	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0835	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0836	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0838	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0839	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0840	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-0840	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1154	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1303	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1303	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-13101	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-13101	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1310	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1310	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1312	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1312	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1313	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1321	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1321	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1330	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1332	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1332	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1338	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1338	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1348	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1348	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1349	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1349	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1355	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1355	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1358	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1358	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1358	VKEKLLWNVKKEHEP	1	16
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1365	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1365	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1366	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1366	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1375	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1375	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1376	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1381	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1381	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1381	VKEKLLWNVKKEHEP	1	16
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1388	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1388	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1389	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1389	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1389	VKEKLLWNVKKEHEP	1	16
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1389	KLLWNVKKEHEPEPL	4	19
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1390	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1390	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1394	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1394	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1395	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1395	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1413	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1413	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1422	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1425	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1463	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1469	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1473	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1473	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1474	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1474	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1478	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1478	KEKLLWNVKKEHEPE	2	17
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1485	EKLLWNVKKEHEPEP	3	18
SGSM2-PTK6	chr17	2241039	chr20	62165057	234	DRB1-1485	KEKLLWNVKKEHEPE	2	17

Top

Fusion breakpoint peptide structures of SGSM2-PTK6

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5814	LWNVKKEHEPEPLP	SGSM2	PTK6	chr17	2241039	chr20	62165057	234

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SGSM2-PTK6

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5814	LWNVKKEHEPEPLP	-7.9962	-8.1096
HLA-B14:02	3BVN	5814	LWNVKKEHEPEPLP	-5.70842	-6.74372
HLA-B52:01	3W39	5814	LWNVKKEHEPEPLP	-6.83737	-6.95077
HLA-B52:01	3W39	5814	LWNVKKEHEPEPLP	-4.4836	-5.5189
HLA-A11:01	4UQ2	5814	LWNVKKEHEPEPLP	-10.0067	-10.1201
HLA-A11:01	4UQ2	5814	LWNVKKEHEPEPLP	-9.03915	-10.0745
HLA-A24:02	5HGA	5814	LWNVKKEHEPEPLP	-6.56204	-6.67544
HLA-A24:02	5HGA	5814	LWNVKKEHEPEPLP	-5.42271	-6.45801
HLA-B44:05	3DX8	5814	LWNVKKEHEPEPLP	-7.85648	-8.89178
HLA-B44:05	3DX8	5814	LWNVKKEHEPEPLP	-5.3978	-5.5112
HLA-A02:01	6TDR	5814	LWNVKKEHEPEPLP	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SGSM2-PTK6

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SGSM2-PTK6	chr17	2241039	chr20	62165057	10	20	KKEHEPEPLP	AAGAAGGAGCACGAGCCTGAGCCCCTGCCC
SGSM2-PTK6	chr17	2241039	chr20	62165057	11	19	KEHEPEPL	AAGGAGCACGAGCCTGAGCCCCTG
SGSM2-PTK6	chr17	2241039	chr20	62165057	11	20	KEHEPEPLP	AAGGAGCACGAGCCTGAGCCCCTGCCC
SGSM2-PTK6	chr17	2241039	chr20	62165057	11	21	KEHEPEPLPH	AAGGAGCACGAGCCTGAGCCCCTGCCCCAT
SGSM2-PTK6	chr17	2241039	chr20	62165057	11	22	KEHEPEPLPHW	AAGGAGCACGAGCCTGAGCCCCTGCCCCATTGG
SGSM2-PTK6	chr17	2241039	chr20	62165057	12	21	EHEPEPLPH	GAGCACGAGCCTGAGCCCCTGCCCCAT
SGSM2-PTK6	chr17	2241039	chr20	62165057	12	22	EHEPEPLPHW	GAGCACGAGCCTGAGCCCCTGCCCCATTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SGSM2-PTK6	chr17	2241039	chr20	62165057	1	16	VKEKLLWNVKKEHEP	GTCAAAGAGAAACTGCTGTGGAACGTGAAGAAGGAGCACGAGCCT
SGSM2-PTK6	chr17	2241039	chr20	62165057	2	17	KEKLLWNVKKEHEPE	AAAGAGAAACTGCTGTGGAACGTGAAGAAGGAGCACGAGCCTGAG
SGSM2-PTK6	chr17	2241039	chr20	62165057	3	18	EKLLWNVKKEHEPEP	GAGAAACTGCTGTGGAACGTGAAGAAGGAGCACGAGCCTGAGCCC
SGSM2-PTK6	chr17	2241039	chr20	62165057	4	19	KLLWNVKKEHEPEPL	AAACTGCTGTGGAACGTGAAGAAGGAGCACGAGCCTGAGCCCCTG

Top

Information of the samples that have these potential fusion neoantigens of SGSM2-PTK6

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SGSM2-PTK6	chr17	2241039	ENST00000268989	chr20	62165057	ENST00000217185	TCGA-CG-5718-01A

Top

Potential target of CAR-T therapy development for SGSM2-PTK6

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SGSM2-PTK6

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SGSM2-PTK6

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)