Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SH3GL1-TAX1BP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SH3GL1-TAX1BP1
	FusionPDB ID: 81462
	FusionGDB2.0 ID: 81462
		Hgene	Tgene
	Gene symbol	SH3GL1	TAX1BP1
	Gene ID	6455	8887
	Gene name	SH3 domain containing GRB2 like 1, endophilin A2	Tax1 binding protein 1
	Synonyms	CNSA1\|EEN\|SH3D2B\|SH3P8	CALCOCO3\|T6BP\|TXBP151
	Cytomap	19p13.3	7p15.2
	Type of gene	protein-coding	protein-coding
	Description	endophilin-A2EEN fusion partner of MLLSH3 domain protein 2BSH3 domain-containing GRB2-like protein 1SH3-containing Grb-2-like 1 proteinSH3-domain GRB2-like 1endophilin-2extra 11-19 leukemia fusionextra eleven-nineteen leukemia fusion gene protein	tax1-binding protein 1TRAF6-binding proteinTax1 (human T-cell leukemia virus type I) binding protein 1
	Modification date	20200313	20200327
	UniProtAcc	Q99961 Main function of 5'-partner protein: FUNCTION: Implicated in endocytosis. May recruit other proteins to membranes with high curvature (By similarity). {ECO:0000250}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000269886, ENST00000417295, ENST00000598564,	ENST00000494033, ENST00000265393, ENST00000396319, ENST00000409980, ENST00000433216, ENST00000543117,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 9 X 12=1944	22 X 14 X 9=2772
	# samples	22	26
	** MAII score	log2(22/1944*10)=-3.14345279008112 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(26/2772*10)=-3.41434372910876 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SH3GL1 [Title/Abstract] AND TAX1BP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SH3GL1 [Title/Abstract] AND TAX1BP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SH3GL1(4400321)-TAX1BP1(27867357), # samples:3
Anticipated loss of major functional domain due to fusion event.	SH3GL1-TAX1BP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SH3GL1-TAX1BP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SH3GL1-TAX1BP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SH3GL1-TAX1BP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:4400321/chr7:27867357)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SH3GL1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TAX1BP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000269886	SH3GL1	chr19	4400321	-	ENST00000543117	TAX1BP1	chr7	27867357	+	773	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400321	-	ENST00000265393	TAX1BP1	chr7	27867357	+	561	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400321	-	ENST00000409980	TAX1BP1	chr7	27867357	+	561	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400321	-	ENST00000433216	TAX1BP1	chr7	27867357	+	544	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400321	-	ENST00000396319	TAX1BP1	chr7	27867357	+	941	224	179	508	109
ENST00000598564	SH3GL1	chr19	4400321	-	ENST00000543117	TAX1BP1	chr7	27867357	+	644	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400321	-	ENST00000265393	TAX1BP1	chr7	27867357	+	432	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400321	-	ENST00000409980	TAX1BP1	chr7	27867357	+	432	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400321	-	ENST00000433216	TAX1BP1	chr7	27867357	+	415	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400321	-	ENST00000396319	TAX1BP1	chr7	27867357	+	812	95	50	379	109
ENST00000417295	SH3GL1	chr19	4400321	-	ENST00000543117	TAX1BP1	chr7	27867357	+	751	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400321	-	ENST00000265393	TAX1BP1	chr7	27867357	+	539	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400321	-	ENST00000409980	TAX1BP1	chr7	27867357	+	539	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400321	-	ENST00000433216	TAX1BP1	chr7	27867357	+	522	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400321	-	ENST00000396319	TAX1BP1	chr7	27867357	+	919	202	157	486	109
ENST00000269886	SH3GL1	chr19	4400320	-	ENST00000543117	TAX1BP1	chr7	27867356	+	773	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400320	-	ENST00000265393	TAX1BP1	chr7	27867356	+	561	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400320	-	ENST00000409980	TAX1BP1	chr7	27867356	+	561	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400320	-	ENST00000433216	TAX1BP1	chr7	27867356	+	544	224	179	508	109
ENST00000269886	SH3GL1	chr19	4400320	-	ENST00000396319	TAX1BP1	chr7	27867356	+	941	224	179	508	109
ENST00000598564	SH3GL1	chr19	4400320	-	ENST00000543117	TAX1BP1	chr7	27867356	+	644	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400320	-	ENST00000265393	TAX1BP1	chr7	27867356	+	432	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400320	-	ENST00000409980	TAX1BP1	chr7	27867356	+	432	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400320	-	ENST00000433216	TAX1BP1	chr7	27867356	+	415	95	50	379	109
ENST00000598564	SH3GL1	chr19	4400320	-	ENST00000396319	TAX1BP1	chr7	27867356	+	812	95	50	379	109
ENST00000417295	SH3GL1	chr19	4400320	-	ENST00000543117	TAX1BP1	chr7	27867356	+	751	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400320	-	ENST00000265393	TAX1BP1	chr7	27867356	+	539	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400320	-	ENST00000409980	TAX1BP1	chr7	27867356	+	539	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400320	-	ENST00000433216	TAX1BP1	chr7	27867356	+	522	202	157	486	109
ENST00000417295	SH3GL1	chr19	4400320	-	ENST00000396319	TAX1BP1	chr7	27867356	+	919	202	157	486	109

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000269886	ENST00000543117	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.015928373	0.9840716
ENST00000269886	ENST00000265393	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.015057571	0.98494244
ENST00000269886	ENST00000409980	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.015057571	0.98494244
ENST00000269886	ENST00000433216	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.015440187	0.9845598
ENST00000269886	ENST00000396319	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.012263182	0.9877368
ENST00000598564	ENST00000543117	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.016173733	0.9838262
ENST00000598564	ENST00000265393	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.021083463	0.9789165
ENST00000598564	ENST00000409980	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.021083463	0.9789165
ENST00000598564	ENST00000433216	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.020398946	0.9796011
ENST00000598564	ENST00000396319	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.014817067	0.98518294
ENST00000417295	ENST00000543117	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.01760063	0.98239934
ENST00000417295	ENST00000265393	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.019820321	0.98017967
ENST00000417295	ENST00000409980	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.019820321	0.98017967
ENST00000417295	ENST00000433216	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.024016112	0.9759839
ENST00000417295	ENST00000396319	SH3GL1	chr19	4400321	-	TAX1BP1	chr7	27867357	+	0.012158832	0.9878412
ENST00000269886	ENST00000543117	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.015928373	0.9840716
ENST00000269886	ENST00000265393	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.015057571	0.98494244
ENST00000269886	ENST00000409980	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.015057571	0.98494244
ENST00000269886	ENST00000433216	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.015440187	0.9845598
ENST00000269886	ENST00000396319	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.012263182	0.9877368
ENST00000598564	ENST00000543117	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.016173733	0.9838262
ENST00000598564	ENST00000265393	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.021083463	0.9789165
ENST00000598564	ENST00000409980	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.021083463	0.9789165
ENST00000598564	ENST00000433216	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.020398946	0.9796011
ENST00000598564	ENST00000396319	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.014817067	0.98518294
ENST00000417295	ENST00000543117	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.01760063	0.98239934
ENST00000417295	ENST00000265393	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.019820321	0.98017967
ENST00000417295	ENST00000409980	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.019820321	0.98017967
ENST00000417295	ENST00000433216	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.024016112	0.9759839
ENST00000417295	ENST00000396319	SH3GL1	chr19	4400320	-	TAX1BP1	chr7	27867356	+	0.012158832	0.9878412

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SH3GL1-TAX1BP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SH3GL1	chr19	4400320	TAX1BP1	chr7	27867356	202	15	VAGLKKQFYKASQEDENVPTAPDPPS
SH3GL1	chr19	4400320	TAX1BP1	chr7	27867356	224	15	VAGLKKQFYKASQEDENVPTAPDPPS
SH3GL1	chr19	4400320	TAX1BP1	chr7	27867356	95	15	VAGLKKQFYKASQEDENVPTAPDPPS
SH3GL1	chr19	4400321	TAX1BP1	chr7	27867357	202	15	VAGLKKQFYKASQEDENVPTAPDPPS
SH3GL1	chr19	4400321	TAX1BP1	chr7	27867357	224	15	VAGLKKQFYKASQEDENVPTAPDPPS
SH3GL1	chr19	4400321	TAX1BP1	chr7	27867357	95	15	VAGLKKQFYKASQEDENVPTAPDPPS

Top

Potential FusionNeoAntigen Information of SH3GL1-TAX1BP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SH3GL1-TAX1BP1_4400320_27867356.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B45:01	QEDENVPTA	0.9965	0.9302	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:02	QEDENVPTA	0.9955	0.7948	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B44:05	QEDENVPTA	0.6034	0.7133	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B41:01	QEDENVPTA	0.545	0.9489	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:01	QEDENVPTA	0.4217	0.9448	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B39:13	QEDENVPTA	0.2074	0.9905	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B45:01	QEDENVPTAP	0.9824	0.9391	12	22
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:02	QEDENVPTAP	0.9582	0.7965	12	22
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B45:01	SQEDENVPTA	0.9511	0.8892	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:02	SQEDENVPTA	0.9456	0.7949	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:01	SQEDENVPTA	0.8402	0.8031	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B41:01	QEDENVPTAP	0.8142	0.9577	12	22
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B41:01	SQEDENVPTA	0.7181	0.9518	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:01	ASQEDENVPTA	0.9901	0.8447	10	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B45:01	ASQEDENVPTA	0.9901	0.9742	10	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:02	ASQEDENVPTA	0.9892	0.8038	10	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B41:01	ASQEDENVPTA	0.9764	0.9653	10	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B40:06	QEDENVPTA	0.9935	0.967	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B44:10	QEDENVPTA	0.8178	0.7498	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B44:09	QEDENVPTA	0.6908	0.7187	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B39:08	QEDENVPTA	0.5129	0.9804	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B40:06	SQEDENVPTA	0.9707	0.878	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B40:04	QEDENVPTA	0.9549	0.8318	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B40:36	QEDENVPTA	0.8513	0.5744	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B41:03	QEDENVPTA	0.6054	0.8233	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B18:11	QEDENVPTA	0.4548	0.9628	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:04	QEDENVPTA	0.4217	0.9448	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:05	QEDENVPTA	0.4217	0.9448	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B39:11	QEDENVPTA	0.3834	0.947	12	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:05	SQEDENVPTA	0.8402	0.8031	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:04	SQEDENVPTA	0.8402	0.8031	11	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:04	ASQEDENVPTA	0.9901	0.8447	10	21
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	HLA-B50:05	ASQEDENVPTA	0.9901	0.8447	10	21

Top

Potential FusionNeoAntigen Information of SH3GL1-TAX1BP1 in HLA II

SH3GL1-TAX1BP1_4400320_27867356.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0901	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0901	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0901	KQFYKASQEDENVPT	5	20
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0902	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0902	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0902	KQFYKASQEDENVPT	5	20
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0903	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0903	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0903	GLKKQFYKASQEDEN	2	17
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0903	KQFYKASQEDENVPT	5	20
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0904	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0904	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0905	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0907	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0908	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0908	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0908	KQFYKASQEDENVPT	5	20
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0908	GLKKQFYKASQEDEN	2	17
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0909	KKQFYKASQEDENVP	4	19
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0909	LKKQFYKASQEDENV	3	18
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	224	DRB1-0909	KQFYKASQEDENVPT	5	20

Top

Fusion breakpoint peptide structures of SH3GL1-TAX1BP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7268	QFYKASQEDENVPT	SH3GL1	TAX1BP1	chr19	4400320	chr7	27867356	224

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SH3GL1-TAX1BP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7268	QFYKASQEDENVPT	-7.9962	-8.1096
HLA-B14:02	3BVN	7268	QFYKASQEDENVPT	-5.70842	-6.74372
HLA-B52:01	3W39	7268	QFYKASQEDENVPT	-6.83737	-6.95077
HLA-B52:01	3W39	7268	QFYKASQEDENVPT	-4.4836	-5.5189
HLA-A11:01	4UQ2	7268	QFYKASQEDENVPT	-10.0067	-10.1201
HLA-A11:01	4UQ2	7268	QFYKASQEDENVPT	-9.03915	-10.0745
HLA-A24:02	5HGA	7268	QFYKASQEDENVPT	-6.56204	-6.67544
HLA-A24:02	5HGA	7268	QFYKASQEDENVPT	-5.42271	-6.45801
HLA-B44:05	3DX8	7268	QFYKASQEDENVPT	-7.85648	-8.89178
HLA-B44:05	3DX8	7268	QFYKASQEDENVPT	-5.3978	-5.5112
HLA-A02:01	6TDR	7268	QFYKASQEDENVPT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SH3GL1-TAX1BP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	10	21	ASQEDENVPTA	GCGAGCCAGGAAGATGAGAATGTGCCTACTGCT
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	11	21	SQEDENVPTA	AGCCAGGAAGATGAGAATGTGCCTACTGCT
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	12	21	QEDENVPTA	CAGGAAGATGAGAATGTGCCTACTGCT
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	12	22	QEDENVPTAP	CAGGAAGATGAGAATGTGCCTACTGCTCCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	2	17	GLKKQFYKASQEDEN	GGGCTGAAGAAGCAGTTCTACAAGGCGAGCCAGGAAGATGAGAAT
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	3	18	LKKQFYKASQEDENV	CTGAAGAAGCAGTTCTACAAGGCGAGCCAGGAAGATGAGAATGTG
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	4	19	KKQFYKASQEDENVP	AAGAAGCAGTTCTACAAGGCGAGCCAGGAAGATGAGAATGTGCCT
SH3GL1-TAX1BP1	chr19	4400320	chr7	27867356	5	20	KQFYKASQEDENVPT	AAGCAGTTCTACAAGGCGAGCCAGGAAGATGAGAATGTGCCTACT

Top

Information of the samples that have these potential fusion neoantigens of SH3GL1-TAX1BP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	SH3GL1-TAX1BP1	chr19	4400320	ENST00000269886	chr7	27867356	ENST00000265393	TCGA-A8-A07W

Top

Potential target of CAR-T therapy development for SH3GL1-TAX1BP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SH3GL1-TAX1BP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SH3GL1-TAX1BP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)