Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SHQ1-SRSF11

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SHQ1-SRSF11
	FusionPDB ID: 81753
	FusionGDB2.0 ID: 81753
		Hgene	Tgene
	Gene symbol	SHQ1	SRSF11
	Gene ID	55164	9295
	Gene name	SHQ1, H/ACA ribonucleoprotein assembly factor	serine and arginine rich splicing factor 11
	Synonyms	GRIM-1\|Shq1p	NET2\|SFRS11\|dJ677H15.2\|p54
	Cytomap	3p13	1p31.1
	Type of gene	protein-coding	protein-coding
	Description	protein SHQ1 homologSHQ1 homologgene associated with retinoid and interferon-induced mortality 1	serine/arginine-rich splicing factor 11SR splicing factor 11arginine-rich 54 kDa nuclear proteinsplicing factor p54splicing factor, arginine/serine-rich 11
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000325599, ENST00000463369, ENST00000468371,	ENST00000370949, ENST00000484162, ENST00000370950, ENST00000370951, ENST00000405432, ENST00000436161, ENST00000454435,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 10 X 4=320	15 X 16 X 5=1200
	# samples	11	18
	** MAII score	log2(11/320*10)=-1.5405683813627 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(18/1200*10)=-2.73696559416621 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SHQ1 [Title/Abstract] AND SRSF11 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SHQ1 [Title/Abstract] AND SRSF11 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SHQ1(72842067)-SRSF11(70694105), # samples:1
Anticipated loss of major functional domain due to fusion event.	SHQ1-SRSF11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SHQ1-SRSF11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SHQ1-SRSF11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SHQ1-SRSF11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SHQ1	GO:0022618	ribonucleoprotein complex assembly	19383767
Hgene	SHQ1	GO:0043065	positive regulation of apoptotic process	20663920
Hgene	SHQ1	GO:2000233	negative regulation of rRNA processing	20663920

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:72842067/chr1:70694105)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SHQ1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SRSF11 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000325599	SHQ1	chr3	72842067	-	ENST00000370951	SRSF11	chr1	70694105	+	3382	1321	140	2569	809
ENST00000325599	SHQ1	chr3	72842067	-	ENST00000405432	SRSF11	chr1	70694105	+	2573	1321	140	2572	811
ENST00000325599	SHQ1	chr3	72842067	-	ENST00000370950	SRSF11	chr1	70694105	+	4820	1321	140	2572	810
ENST00000325599	SHQ1	chr3	72842067	-	ENST00000454435	SRSF11	chr1	70694105	+	1993	1321	140	1513	457
ENST00000325599	SHQ1	chr3	72842067	-	ENST00000436161	SRSF11	chr1	70694105	+	1957	1321	140	1504	454
ENST00000463369	SHQ1	chr3	72842067	-	ENST00000370951	SRSF11	chr1	70694105	+	3248	1187	24	2435	803
ENST00000463369	SHQ1	chr3	72842067	-	ENST00000405432	SRSF11	chr1	70694105	+	2439	1187	24	2438	804
ENST00000463369	SHQ1	chr3	72842067	-	ENST00000370950	SRSF11	chr1	70694105	+	4686	1187	24	2438	804
ENST00000463369	SHQ1	chr3	72842067	-	ENST00000454435	SRSF11	chr1	70694105	+	1859	1187	24	1379	451
ENST00000463369	SHQ1	chr3	72842067	-	ENST00000436161	SRSF11	chr1	70694105	+	1823	1187	24	1370	448

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000325599	ENST00000370951	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.000734068	0.99926597
ENST00000325599	ENST00000405432	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.002077475	0.9979226
ENST00000325599	ENST00000370950	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.000243542	0.9997565
ENST00000325599	ENST00000454435	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.000379991	0.99961996
ENST00000325599	ENST00000436161	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.000779672	0.9992204
ENST00000463369	ENST00000370951	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.00077536	0.99922466
ENST00000463369	ENST00000405432	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.00230336	0.9976966
ENST00000463369	ENST00000370950	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.00025569	0.99974436
ENST00000463369	ENST00000454435	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.000548906	0.9994511
ENST00000463369	ENST00000436161	SHQ1	chr3	72842067	-	SRSF11	chr1	70694105	+	0.001315437	0.9986846

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SHQ1-SRSF11

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SHQ1	chr3	72842067	SRSF11	chr1	70694105	1187	388	YISDYCVWIQKVNDSPLPVSSRVCFV
SHQ1	chr3	72842067	SRSF11	chr1	70694105	1321	394	YISDYCVWIQKVNDSPLPVSSRVCFV

Top

Potential FusionNeoAntigen Information of SHQ1-SRSF11 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SHQ1-SRSF11_72842067_70694105.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:38	KVNDSPLPV	0.9936	0.5142	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:21	KVNDSPLPV	0.9876	0.6639	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:13	KVNDSPLPV	0.9862	0.5473	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A30:08	KVNDSPLPV	0.9852	0.8	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:04	KVNDSPLPV	0.9842	0.534	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:60	KVNDSPLPV	0.9823	0.5049	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:11	KVNDSPLPV	0.9823	0.5517	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:30	KVNDSPLPV	0.9817	0.5293	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:67	KVNDSPLPV	0.9817	0.5293	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:35	KVNDSPLPV	0.9817	0.5645	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:24	KVNDSPLPV	0.9817	0.5293	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:29	KVNDSPLPV	0.9781	0.5314	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:20	KVNDSPLPV	0.9724	0.5305	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-B13:02	KVNDSPLPV	0.4472	0.7072	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C15:06	KVNDSPLPV	0.9987	0.8759	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C04:06	KVNDSPLPV	0.9985	0.8756	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C15:04	KVNDSPLPV	0.9979	0.8524	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-B15:04	IQKVNDSPL	0.9891	0.7684	8	17
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:01	KVNDSPLPV	0.9817	0.5293	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C02:06	KVNDSPLPV	0.9417	0.8973	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C08:13	KVNDSPLPV	0.9328	0.9524	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C08:04	KVNDSPLPV	0.9328	0.9524	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C15:02	KVNDSPLPV	0.9993	0.8477	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C15:05	KVNDSPLPV	0.9992	0.883	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C15:09	KVNDSPLPV	0.9979	0.8524	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:03	KVNDSPLPV	0.9893	0.5224	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:14	KVNDSPLPV	0.9878	0.5072	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A02:06	KVNDSPLPV	0.9876	0.6639	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-B15:73	IQKVNDSPL	0.9872	0.6707	8	17
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A30:01	KVNDSPLPV	0.9858	0.9018	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-B15:30	IQKVNDSPL	0.9701	0.6925	8	17
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-A32:01	KVNDSPLPV	0.8455	0.94	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C17:01	KVNDSPLPV	0.8008	0.8836	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-B07:13	KVNDSPLPV	0.5419	0.7082	10	19
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	HLA-C07:04	KVNDSPLPV	0.4392	0.9338	10	19

Top

Potential FusionNeoAntigen Information of SHQ1-SRSF11 in HLA II

SHQ1-SRSF11_72842067_70694105.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0101	DYCVWIQKVNDSPLP	3	18
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0103	DYCVWIQKVNDSPLP	3	18
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0104	DYCVWIQKVNDSPLP	3	18
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0106	DYCVWIQKVNDSPLP	3	18
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0107	DYCVWIQKVNDSPLP	3	18
SHQ1-SRSF11	chr3	72842067	chr1	70694105	1321	DRB4-0108	DYCVWIQKVNDSPLP	3	18

Top

Fusion breakpoint peptide structures of SHQ1-SRSF11

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10388	VWIQKVNDSPLPVS	SHQ1	SRSF11	chr3	72842067	chr1	70694105	1321

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SHQ1-SRSF11

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10388	VWIQKVNDSPLPVS	-8.55667	-8.74867
HLA-B14:02	3BVN	10388	VWIQKVNDSPLPVS	-3.49457	-4.25557
HLA-B52:01	3W39	10388	VWIQKVNDSPLPVS	-7.26725	-7.45925
HLA-B52:01	3W39	10388	VWIQKVNDSPLPVS	-4.01461	-4.77561
HLA-A24:02	5HGA	10388	VWIQKVNDSPLPVS	-7.65911	-8.42011
HLA-A24:02	5HGA	10388	VWIQKVNDSPLPVS	-7.10204	-7.29404
HLA-B44:05	3DX8	10388	VWIQKVNDSPLPVS	-7.5556	-8.3166
HLA-B44:05	3DX8	10388	VWIQKVNDSPLPVS	-2.76159	-2.95359
HLA-B35:01	1A1N	10388	VWIQKVNDSPLPVS	-5.4014	-6.1624
HLA-B35:01	1A1N	10388	VWIQKVNDSPLPVS	-4.87859	-5.07059

Top

Vaccine Design for the FusionNeoAntigens of SHQ1-SRSF11

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SHQ1-SRSF11	chr3	72842067	chr1	70694105	10	19	KVNDSPLPV	GAAAGTCAATGATTCGCCTTTGCCAGT
SHQ1-SRSF11	chr3	72842067	chr1	70694105	8	17	IQKVNDSPL	GATTCAGAAAGTCAATGATTCGCCTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SHQ1-SRSF11	chr3	72842067	chr1	70694105	3	18	DYCVWIQKVNDSPLP	AGACTACTGTGTGTGGATTCAGAAAGTCAATGATTCGCCTTTGCC

Top

Information of the samples that have these potential fusion neoantigens of SHQ1-SRSF11

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SHQ1-SRSF11	chr3	72842067	ENST00000325599	chr1	70694105	ENST00000370950	TCGA-BR-8366-01A

Top

Potential target of CAR-T therapy development for SHQ1-SRSF11

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SHQ1-SRSF11

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SHQ1-SRSF11

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)