Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SKP1-RUNX1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SKP1-RUNX1
	FusionPDB ID: 82160
	FusionGDB2.0 ID: 82160
		Hgene	Tgene
	Gene symbol	SKP1	RUNX1
	Gene ID	6500	861
	Gene name	S-phase kinase associated protein 1	RUNX family transcription factor 1
	Synonyms	EMC19\|OCP-II\|OCP2\|SKP1A\|TCEB1L\|p19A	AML1\|AML1-EVI-1\|AMLCR1\|CBF2alpha\|CBFA2\|EVI-1\|PEBP2aB\|PEBP2alpha
	Cytomap	5q31.1	21q22.12
	Type of gene	protein-coding	protein-coding
	Description	S-phase kinase-associated protein 1OCP-2RNA polymerase II elongation factor-like protein OCP2SIIIcyclin A/CDK2-associated p19cyclin-A/CDK2-associated protein p19organ of Corti protein 2organ of Corti protein IIp19skp1transcription elongation fact	runt-related transcription factor 1AML1-EVI-1 fusion proteinPEA2-alpha BPEBP2-alpha BSL3-3 enhancer factor 1 alpha B subunitSL3/AKV core-binding factor alpha B subunitacute myeloid leukemia 1 proteincore-binding factor, runt domain, alpha subunit 2
	Modification date	20200327	20200322
	UniProtAcc	.	Q06455 Main function of 5'-partner protein: FUNCTION: Transcriptional corepressor which facilitates transcriptional repression via its association with DNA-binding transcription factors and recruitment of other corepressors and histone-modifying enzymes (PubMed:12559562, PubMed:15203199, PubMed:10688654). Can repress the expression of MMP7 in a ZBTB33-dependent manner (PubMed:23251453). Can repress transactivation mediated by TCF12 (PubMed:16803958). Acts as a negative regulator of adipogenesis (By similarity). The AML1-MTG8/ETO fusion protein frequently found in leukemic cells is involved in leukemogenesis and contributes to hematopoietic stem/progenitor cell self-renewal (PubMed:23812588). {ECO:0000250\|UniProtKB:Q61909, ECO:0000269\|PubMed:10688654, ECO:0000269\|PubMed:10973986, ECO:0000269\|PubMed:16803958, ECO:0000269\|PubMed:23251453, ECO:0000269\|PubMed:23812588, ECO:0000303\|PubMed:12559562, ECO:0000303\|PubMed:15203199}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000353411, ENST00000517625, ENST00000521216, ENST00000522552, ENST00000522855,	ENST00000358356, ENST00000486278, ENST00000494829, ENST00000300305, ENST00000325074, ENST00000344691, ENST00000399240, ENST00000437180,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 11 X 4=484	36 X 59 X 13=27612
	# samples	11	63
	** MAII score	log2(11/484*10)=-2.13750352374993 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(63/27612*10)=-5.45379975055797 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SKP1 [Title/Abstract] AND RUNX1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SKP1 [Title/Abstract] AND RUNX1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SKP1(133509617)-RUNX1(36171759), # samples:1
Anticipated loss of major functional domain due to fusion event.	SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. SKP1-RUNX1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SKP1-RUNX1 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. SKP1-RUNX1 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. SKP1-RUNX1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SKP1	GO:0016567	protein ubiquitination	15103331
Hgene	SKP1	GO:0031146	SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	15103331\|20347421
Hgene	SKP1	GO:0035518	histone H2A monoubiquitination	16943429
Tgene	RUNX1	GO:0030097	hemopoiesis	21873977
Tgene	RUNX1	GO:0045893	positive regulation of transcription, DNA-templated	10207087\|14970218
Tgene	RUNX1	GO:0045944	positive regulation of transcription by RNA polymerase II	9199349\|10207087\|14970218\|21873977

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:133509617/chr21:36171759)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SKP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RUNX1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000353411	SKP1	chr5	133509617	-	ENST00000344691	RUNX1	chr21	36171759	-	5253	281	1263	439	274
ENST00000353411	SKP1	chr5	133509617	-	ENST00000325074	RUNX1	chr21	36171759	-	5253	281	1263	439	274
ENST00000353411	SKP1	chr5	133509617	-	ENST00000437180	RUNX1	chr21	36171759	-	5253	281	1263	439	274
ENST00000353411	SKP1	chr5	133509617	-	ENST00000300305	RUNX1	chr21	36171759	-	5253	281	1263	439	274
ENST00000353411	SKP1	chr5	133509617	-	ENST00000399240	RUNX1	chr21	36171759	-	1268	281	1263	439	274
ENST00000522552	SKP1	chr5	133509617	-	ENST00000344691	RUNX1	chr21	36171759	-	5179	207	1189	365	274
ENST00000522552	SKP1	chr5	133509617	-	ENST00000325074	RUNX1	chr21	36171759	-	5179	207	1189	365	274
ENST00000522552	SKP1	chr5	133509617	-	ENST00000437180	RUNX1	chr21	36171759	-	5179	207	1189	365	274
ENST00000522552	SKP1	chr5	133509617	-	ENST00000300305	RUNX1	chr21	36171759	-	5179	207	1189	365	274
ENST00000522552	SKP1	chr5	133509617	-	ENST00000399240	RUNX1	chr21	36171759	-	1194	207	1189	365	274
ENST00000521216	SKP1	chr5	133509617	-	ENST00000344691	RUNX1	chr21	36171759	-	5135	163	1145	321	274
ENST00000521216	SKP1	chr5	133509617	-	ENST00000325074	RUNX1	chr21	36171759	-	5135	163	1145	321	274
ENST00000521216	SKP1	chr5	133509617	-	ENST00000437180	RUNX1	chr21	36171759	-	5135	163	1145	321	274
ENST00000521216	SKP1	chr5	133509617	-	ENST00000300305	RUNX1	chr21	36171759	-	5135	163	1145	321	274
ENST00000521216	SKP1	chr5	133509617	-	ENST00000399240	RUNX1	chr21	36171759	-	1150	163	1145	321	274
ENST00000517625	SKP1	chr5	133509617	-	ENST00000344691	RUNX1	chr21	36171759	-	5228	256	45	893	282
ENST00000517625	SKP1	chr5	133509617	-	ENST00000325074	RUNX1	chr21	36171759	-	5228	256	45	893	282
ENST00000517625	SKP1	chr5	133509617	-	ENST00000437180	RUNX1	chr21	36171759	-	5228	256	45	893	282
ENST00000517625	SKP1	chr5	133509617	-	ENST00000300305	RUNX1	chr21	36171759	-	5228	256	45	893	282
ENST00000517625	SKP1	chr5	133509617	-	ENST00000399240	RUNX1	chr21	36171759	-	1243	256	45	893	282

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000353411	ENST00000344691	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00286003	0.99714005
ENST00000353411	ENST00000325074	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00286003	0.99714005
ENST00000353411	ENST00000437180	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00286003	0.99714005
ENST00000353411	ENST00000300305	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00286003	0.99714005
ENST00000353411	ENST00000399240	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.009004016	0.99099606
ENST00000522552	ENST00000344691	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002960918	0.9970391
ENST00000522552	ENST00000325074	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002960918	0.9970391
ENST00000522552	ENST00000437180	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002960918	0.9970391
ENST00000522552	ENST00000300305	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002960918	0.9970391
ENST00000522552	ENST00000399240	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.011086402	0.9889136
ENST00000521216	ENST00000344691	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002930139	0.99706984
ENST00000521216	ENST00000325074	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002930139	0.99706984
ENST00000521216	ENST00000437180	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002930139	0.99706984
ENST00000521216	ENST00000300305	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.002930139	0.99706984
ENST00000521216	ENST00000399240	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.010235435	0.9897646
ENST00000517625	ENST00000344691	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00253121	0.9974688
ENST00000517625	ENST00000325074	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00253121	0.9974688
ENST00000517625	ENST00000437180	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00253121	0.9974688
ENST00000517625	ENST00000300305	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.00253121	0.9974688
ENST00000517625	ENST00000399240	SKP1	chr5	133509617	-	RUNX1	chr21	36171759	-	0.014468181	0.9855318

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SKP1-RUNX1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SKP1	chr5	133509617	RUNX1	chr21	36171759	256	70	IAKQSVTIKTMLEDTRQIQPSPPWSY

Top

Potential FusionNeoAntigen Information of SKP1-RUNX1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SKP1-RUNX1_133509617_36171759.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B45:01	LEDTRQIQP	0.9867	0.8892	11	20
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B50:02	LEDTRQIQP	0.9696	0.6534	11	20
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:38	TMLEDTRQI	0.9436	0.6753	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:11	TMLEDTRQI	0.9339	0.5133	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:22	TMLEDTRQI	0.9281	0.5013	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:04	TMLEDTRQI	0.9151	0.6219	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:27	TMLEDTRQI	0.913	0.5962	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:13	TMLEDTRQI	0.9126	0.7112	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:21	TMLEDTRQI	0.9053	0.6327	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B41:01	LEDTRQIQP	0.6416	0.9757	11	20
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B50:01	LEDTRQIQP	0.4937	0.8325	11	20
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B52:01	TMLEDTRQI	0.4028	0.9561	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B13:02	TMLEDTRQI	0.2231	0.715	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B13:01	TMLEDTRQI	0.1493	0.9257	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:03	TMLEDTRQI	0.9435	0.6794	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:14	TMLEDTRQI	0.9125	0.5535	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-A02:06	TMLEDTRQI	0.9053	0.6327	9	18
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B50:04	LEDTRQIQP	0.4937	0.8325	11	20
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	HLA-B50:05	LEDTRQIQP	0.4937	0.8325	11	20

Top

Potential FusionNeoAntigen Information of SKP1-RUNX1 in HLA II

SKP1-RUNX1_133509617_36171759.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0301	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0301	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0303	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0305	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0307	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0307	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0307	KTMLEDTRQIQPSPP	8	23
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0310	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0313	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0313	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0315	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0315	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0318	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0318	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0320	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0320	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0320	KTMLEDTRQIQPSPP	8	23
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0322	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0322	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0324	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0324	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0326	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0326	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0328	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0328	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0330	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0330	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0332	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0332	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0334	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0334	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0336	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0336	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0340	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0344	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0344	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0346	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0346	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0348	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0348	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0350	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0350	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0352	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0352	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0354	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0354	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0806	KQSVTIKTMLEDTRQ	2	17
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0806	AKQSVTIKTMLEDTR	1	16
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0810	KQSVTIKTMLEDTRQ	2	17
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0810	AKQSVTIKTMLEDTR	1	16
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0812	KQSVTIKTMLEDTRQ	2	17
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0822	KQSVTIKTMLEDTRQ	2	17
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-0822	AKQSVTIKTMLEDTR	1	16
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1107	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1107	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1107	KTMLEDTRQIQPSPP	8	23
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1179	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1333	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1394	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1394	TIKTMLEDTRQIQPS	6	21
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1421	IKTMLEDTRQIQPSP	7	22
SKP1-RUNX1	chr5	133509617	chr21	36171759	256	DRB1-1478	KQSVTIKTMLEDTRQ	2	17

Top

Fusion breakpoint peptide structures of SKP1-RUNX1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9405	TIKTMLEDTRQIQP	SKP1	RUNX1	chr5	133509617	chr21	36171759	256

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SKP1-RUNX1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9405	TIKTMLEDTRQIQP	-7.9962	-8.1096
HLA-B14:02	3BVN	9405	TIKTMLEDTRQIQP	-5.70842	-6.74372
HLA-B52:01	3W39	9405	TIKTMLEDTRQIQP	-6.83737	-6.95077
HLA-B52:01	3W39	9405	TIKTMLEDTRQIQP	-4.4836	-5.5189
HLA-A11:01	4UQ2	9405	TIKTMLEDTRQIQP	-10.0067	-10.1201
HLA-A11:01	4UQ2	9405	TIKTMLEDTRQIQP	-9.03915	-10.0745
HLA-A24:02	5HGA	9405	TIKTMLEDTRQIQP	-6.56204	-6.67544
HLA-A24:02	5HGA	9405	TIKTMLEDTRQIQP	-5.42271	-6.45801
HLA-B44:05	3DX8	9405	TIKTMLEDTRQIQP	-7.85648	-8.89178
HLA-B44:05	3DX8	9405	TIKTMLEDTRQIQP	-5.3978	-5.5112
HLA-A02:01	6TDR	9405	TIKTMLEDTRQIQP	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SKP1-RUNX1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SKP1-RUNX1	chr5	133509617	chr21	36171759	11	20	LEDTRQIQP	TGGAAGATACAAGGCAGATCCAACCAT
SKP1-RUNX1	chr5	133509617	chr21	36171759	9	18	TMLEDTRQI	CCATGTTGGAAGATACAAGGCAGATCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SKP1-RUNX1	chr5	133509617	chr21	36171759	1	16	AKQSVTIKTMLEDTR	CCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATACAAGGC
SKP1-RUNX1	chr5	133509617	chr21	36171759	2	17	KQSVTIKTMLEDTRQ	AACAATCTGTGACTATTAAGACCATGTTGGAAGATACAAGGCAGA
SKP1-RUNX1	chr5	133509617	chr21	36171759	6	21	TIKTMLEDTRQIQPS	CTATTAAGACCATGTTGGAAGATACAAGGCAGATCCAACCATCCC
SKP1-RUNX1	chr5	133509617	chr21	36171759	7	22	IKTMLEDTRQIQPSP	TTAAGACCATGTTGGAAGATACAAGGCAGATCCAACCATCCCCAC
SKP1-RUNX1	chr5	133509617	chr21	36171759	8	23	KTMLEDTRQIQPSPP	AGACCATGTTGGAAGATACAAGGCAGATCCAACCATCCCCACCGT

Top

Information of the samples that have these potential fusion neoantigens of SKP1-RUNX1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	SKP1-RUNX1	chr5	133509617	ENST00000517625	chr21	36171759	ENST00000300305	TCGA-AR-A1AR-01A

Top

Potential target of CAR-T therapy development for SKP1-RUNX1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SKP1-RUNX1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SKP1-RUNX1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	RUNX1	C1832388	Platelet Disorder, Familial, with Associated Myeloid Malignancy	11	CLINGEN;CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Tgene	RUNX1	C0023467	Leukemia, Myelocytic, Acute	4	CGI;CTD_human;GENOMICS_ENGLAND
Tgene	RUNX1	C0026998	Acute Myeloid Leukemia, M1	3	CTD_human
Tgene	RUNX1	C1879321	Acute Myeloid Leukemia (AML-M2)	3	CTD_human
Tgene	RUNX1	C0023485	Precursor B-Cell Lymphoblastic Leukemia-Lymphoma	2	CTD_human
Tgene	RUNX1	C0003873	Rheumatoid Arthritis	1	CTD_human
Tgene	RUNX1	C0006413	Burkitt Lymphoma	1	ORPHANET
Tgene	RUNX1	C0017636	Glioblastoma	1	CTD_human
Tgene	RUNX1	C0023452	Childhood Acute Lymphoblastic Leukemia	1	CTD_human
Tgene	RUNX1	C0023453	L2 Acute Lymphoblastic Leukemia	1	CTD_human
Tgene	RUNX1	C0023473	Myeloid Leukemia, Chronic	1	ORPHANET
Tgene	RUNX1	C0033578	Prostatic Neoplasms	1	CTD_human
Tgene	RUNX1	C0040034	Thrombocytopenia	1	GENOMICS_ENGLAND
Tgene	RUNX1	C0334588	Giant Cell Glioblastoma	1	CTD_human
Tgene	RUNX1	C0349639	Juvenile Myelomonocytic Leukemia	1	CTD_human
Tgene	RUNX1	C0376358	Malignant neoplasm of prostate	1	CTD_human
Tgene	RUNX1	C1292769	Precursor B-cell lymphoblastic leukemia	1	ORPHANET
Tgene	RUNX1	C1621958	Glioblastoma Multiforme	1	CTD_human
Tgene	RUNX1	C1961102	Precursor Cell Lymphoblastic Leukemia Lymphoma	1	CTD_human
Tgene	RUNX1	C2713368	Hematopoetic Myelodysplasia	1	CTD_human
Tgene	RUNX1	C3463824	MYELODYSPLASTIC SYNDROME	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)