Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SLC30A6-BRE

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SLC30A6-BRE
	FusionPDB ID: 82886
	FusionGDB2.0 ID: 82886
		Hgene	Tgene
	Gene symbol	SLC30A6	BRE
	Gene ID	55676	9577
	Gene name	solute carrier family 30 member 6	BRISC and BRCA1 A complex member 2
	Synonyms	MST103\|MSTP103\|ZNT6	BRCC4\|BRCC45\|BRE
	Cytomap	2p22.3	2p23.2
	Type of gene	protein-coding	protein-coding
	Description	zinc transporter 6solute carrier family 30 (zinc transporter), member 6	BRISC and BRCA1-A complex member 2BRCA1-A complex subunit BREBRCA1/BRCA2-containing complex subunit 45BRCA1/BRCA2-containing complex, subunit 4brain and reproductive organ-expressed (TNFRSF1A modulator)brain and reproductive organ-expressed protein
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000282587, ENST00000379343, ENST00000435660, ENST00000538303, ENST00000357055, ENST00000406369,	ENST00000603461, ENST00000342045, ENST00000344773, ENST00000361704, ENST00000379624, ENST00000379632,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 11 X 5=605	20 X 20 X 12=4800
	# samples	13	30
	** MAII score	log2(13/605*10)=-2.2184235191335 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(30/4800*10)=-4 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SLC30A6 [Title/Abstract] AND BRE [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SLC30A6 [Title/Abstract] AND BRE [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SLC30A6(32400430)-BRE(28460069), # samples:3
Anticipated loss of major functional domain due to fusion event.	SLC30A6-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC30A6-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC30A6-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SLC30A6-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	BRE	GO:0043066	negative regulation of apoptotic process	15465831

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:32400430/chr2:28460069)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SLC30A6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BRE (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460069	+	1202	168	37	735	232
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460069	+	1028	168	37	639	200
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460069	+	1028	168	37	639	200
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460069	+	1100	168	37	618	193
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460069	+	1100	168	37	618	193
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460069	+	1289	255	37	822	261
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460069	+	1289	255	37	822	261
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460069	+	1289	255	37	822	261
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460069	+	1115	255	37	726	229
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460069	+	1187	255	37	705	222
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460068	+	1202	168	37	735	232
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460068	+	1028	168	37	639	200
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460068	+	1028	168	37	639	200
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460068	+	1100	168	37	618	193
ENST00000538303	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460068	+	1100	168	37	618	193
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460068	+	1289	255	37	822	261
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460068	+	1187	255	37	705	222
ENST00000379343	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460068	+	1187	255	37	705	222
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460068	+	1289	255	37	822	261
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460068	+	1187	255	37	705	222
ENST00000435660	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460068	+	1187	255	37	705	222
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000344773	BRE	chr2	28460068	+	1289	255	37	822	261
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000379624	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000342045	BRE	chr2	28460068	+	1115	255	37	726	229
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000379632	BRE	chr2	28460068	+	1187	255	37	705	222
ENST00000282587	SLC30A6	chr2	32400430	+	ENST00000361704	BRE	chr2	28460068	+	1187	255	37	705	222

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000538303	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.043953765	0.9560463
ENST00000538303	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.008396558	0.99160343
ENST00000538303	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.008396558	0.99160343
ENST00000538303	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.015044466	0.9849555
ENST00000538303	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.015044466	0.9849555
ENST00000379343	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.17353292	0.8264671
ENST00000379343	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000379343	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000379343	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000379343	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000435660	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.17353292	0.8264671
ENST00000435660	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000435660	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000435660	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000435660	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000282587	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.17353292	0.8264671
ENST00000282587	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000282587	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.021926872	0.9780732
ENST00000282587	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000282587	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460069	+	0.045775495	0.9542245
ENST00000538303	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.043953765	0.9560463
ENST00000538303	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.008396558	0.99160343
ENST00000538303	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.008396558	0.99160343
ENST00000538303	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.015044466	0.9849555
ENST00000538303	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.015044466	0.9849555
ENST00000379343	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.17353292	0.8264671
ENST00000379343	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000379343	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000379343	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245
ENST00000379343	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245
ENST00000435660	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.17353292	0.8264671
ENST00000435660	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000435660	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000435660	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245
ENST00000435660	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245
ENST00000282587	ENST00000344773	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.17353292	0.8264671
ENST00000282587	ENST00000379624	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000282587	ENST00000342045	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.021926872	0.9780732
ENST00000282587	ENST00000379632	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245
ENST00000282587	ENST00000361704	SLC30A6	chr2	32400430	+	BRE	chr2	28460068	+	0.045775495	0.9542245

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SLC30A6-BRE

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SLC30A6	chr2	32400430	BRE	chr2	28460068	168	42	ALTAYTYLTIFDLFSALGGSSALHIP
SLC30A6	chr2	32400430	BRE	chr2	28460068	255	71	ALTAYTYLTIFDLFSALGGSSALHIP
SLC30A6	chr2	32400430	BRE	chr2	28460069	168	42	ALTAYTYLTIFDLFSALGGSSALHIP
SLC30A6	chr2	32400430	BRE	chr2	28460069	255	71	ALTAYTYLTIFDLFSALGGSSALHIP

Top

Potential FusionNeoAntigen Information of SLC30A6-BRE in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SLC30A6-BRE_32400430_28460068.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A02:38	TIFDLFSAL	0.9839	0.5937	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A02:04	TIFDLFSAL	0.9447	0.5675	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B35:04	TIFDLFSAL	0.8535	0.9632	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B35:02	TIFDLFSAL	0.8535	0.9632	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:07	IFDLFSAL	1	0.8142	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:10	IFDLFSAL	1	0.8075	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:14	IFDLFSAL	0.9981	0.82	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:19	TIFDLFSAL	0.9984	0.9886	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:07	TIFDLFSAL	0.9983	0.9629	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:08	TIFDLFSAL	0.9981	0.8896	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:06	TIFDLFSAL	0.9837	0.8733	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C08:13	TIFDLFSAL	0.9756	0.951	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C08:04	TIFDLFSAL	0.9756	0.951	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B15:04	TIFDLFSAL	0.933	0.9329	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B35:12	TIFDLFSAL	0.8535	0.9632	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C02:06	TIFDLFSAL	0.8494	0.9342	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:14	TIFDLFSAL	0.8347	0.9692	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C01:17	TIFDLFSAL	0.8235	0.9305	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C01:30	TIFDLFSAL	0.7162	0.9576	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:01	IFDLFSAL	1	0.8142	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:03	IFDLFSAL	1	0.8406	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C18:01	IFDLFSAL	1	0.8199	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C14:02	IFDLFSAL	0.9992	0.9278	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C14:03	IFDLFSAL	0.9992	0.9278	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C04:04	IFDLFSAL	0.9987	0.8453	9	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:03	TIFDLFSAL	0.9986	0.9881	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:04	TIFDLFSAL	0.9986	0.9881	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C12:03	TIFDLFSAL	0.9966	0.9804	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:17	TIFDLFSAL	0.9964	0.9577	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:05	TIFDLFSAL	0.9958	0.9244	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C12:02	TIFDLFSAL	0.9955	0.9576	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:67	TIFDLFSAL	0.9949	0.981	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:02	TIFDLFSAL	0.9865	0.9577	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A68:02	TIFDLFSAL	0.9846	0.7285	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A02:03	TIFDLFSAL	0.9818	0.5472	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C03:06	TIFDLFSAL	0.9784	0.9895	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A69:01	TIFDLFSAL	0.9724	0.5569	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B15:08	TIFDLFSAL	0.969	0.8515	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B15:73	TIFDLFSAL	0.9457	0.9668	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B15:30	TIFDLFSAL	0.9281	0.9054	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B35:13	TIFDLFSAL	0.9144	0.936	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C01:02	TIFDLFSAL	0.854	0.921	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-B35:09	TIFDLFSAL	0.8535	0.9632	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-A25:01	TIFDLFSAL	0.8227	0.9141	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C17:01	TIFDLFSAL	0.6716	0.887	8	17
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C14:03	TYLTIFDLF	0.0489	0.9246	5	14
SLC30A6-BRE	chr2	32400430	chr2	28460068	255	HLA-C14:02	TYLTIFDLF	0.0489	0.9246	5	14

Top

Potential FusionNeoAntigen Information of SLC30A6-BRE in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SLC30A6-BRE

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10727	YLTIFDLFSALGGS	SLC30A6	BRE	chr2	32400430	chr2	28460068	255

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SLC30A6-BRE

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10727	YLTIFDLFSALGGS	-7.15543	-7.26883
HLA-B14:02	3BVN	10727	YLTIFDLFSALGGS	-4.77435	-5.80965
HLA-B52:01	3W39	10727	YLTIFDLFSALGGS	-6.80875	-6.92215
HLA-B52:01	3W39	10727	YLTIFDLFSALGGS	-4.20386	-5.23916
HLA-A11:01	4UQ2	10727	YLTIFDLFSALGGS	-7.5194	-8.5547
HLA-A11:01	4UQ2	10727	YLTIFDLFSALGGS	-6.9601	-7.0735
HLA-A24:02	5HGA	10727	YLTIFDLFSALGGS	-7.52403	-7.63743
HLA-A24:02	5HGA	10727	YLTIFDLFSALGGS	-5.82433	-6.85963
HLA-B27:05	6PYJ	10727	YLTIFDLFSALGGS	-3.28285	-4.31815
HLA-B44:05	3DX8	10727	YLTIFDLFSALGGS	-5.91172	-6.94702
HLA-B44:05	3DX8	10727	YLTIFDLFSALGGS	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of SLC30A6-BRE

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SLC30A6-BRE	chr2	32400430	chr2	28460068	5	14	TYLTIFDLF	CCTGACCATTTTTGATCTTTTTAGTGC
SLC30A6-BRE	chr2	32400430	chr2	28460068	8	17	TIFDLFSAL	TTTTGATCTTTTTAGTGCACTTGGAGG
SLC30A6-BRE	chr2	32400430	chr2	28460068	9	17	IFDLFSAL	TGATCTTTTTAGTGCACTTGGAGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SLC30A6-BRE

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	SLC30A6-BRE	chr2	32400430	ENST00000282587	chr2	28460068	ENST00000342045	TCGA-57-1583

Top

Potential target of CAR-T therapy development for SLC30A6-BRE

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

SLC30A6

chr2:32400430

chr2:28460068

ENST00000282587

34_54

462.0

Transmembrane

Helical

Hgene

SLC30A6

chr2:32400430

chr2:28460068

ENST00000379343

34_54

502.0

Transmembrane

Helical

Hgene

SLC30A6

chr2:32400430

chr2:28460068

ENST00000435660

34_54

439.0

Transmembrane

Helical

Hgene

SLC30A6

chr2:32400430

chr2:28460069

ENST00000282587

34_54

462.0

Transmembrane

Helical

Hgene

SLC30A6

chr2:32400430

chr2:28460069

ENST00000379343

34_54

502.0

Transmembrane

Helical

Hgene

SLC30A6

chr2:32400430

chr2:28460069

ENST00000435660

34_54

439.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SLC30A6-BRE

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SLC30A6-BRE

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)