![]() |
|||||||
|
Fusion Protein:SLC45A3-EPB41L4B |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SLC45A3-EPB41L4B | FusionPDB ID: 83326 | FusionGDB2.0 ID: 83326 | Hgene | Tgene | Gene symbol | SLC45A3 | EPB41L4B | Gene ID | 85414 | 54566 |
Gene name | solute carrier family 45 member 3 | erythrocyte membrane protein band 4.1 like 4B | |
Synonyms | IPCA-2|IPCA-6|IPCA-8|IPCA6|PCANAP2|PCANAP6|PCANAP8|PRST | CG1|EHM2|LULU2 | |
Cytomap | 1q32.1 | 9q31.3 | |
Type of gene | protein-coding | protein-coding | |
Description | solute carrier family 45 member 3prostate cancer associated protein 2prostate cancer associated protein 6prostate cancer associated protein 8prostate cancer-associated gene 2prostate cancer-associated gene 6prostate cancer-associated gene 8prostein | band 4.1-like protein 4BFERM-containing protein CG1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q9H329 Main function of 5'-partner protein: FUNCTION: Up-regulates the activity of the Rho guanine nucleotide exchange factor ARHGEF18 (By similarity). Involved in the regulation of the circumferential actomyosin belt in epithelial cells (PubMed:22006950). Promotes cellular adhesion, migration and motility in vitro and may play a role in wound healing (PubMed:23664528). May have a role in mediating cytoskeletal changes associated with steroid-induced cell differentiation (PubMed:14521927). {ECO:0000250|UniProtKB:Q9JMC8, ECO:0000269|PubMed:14521927, ECO:0000269|PubMed:22006950, ECO:0000269|PubMed:23664528}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000460934, ENST00000367145, | ENST00000374557, ENST00000374566, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 18 X 4=1512 | 10 X 10 X 4=400 |
# samples | 33 | 13 | |
** MAII score | log2(33/1512*10)=-2.19592020997526 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(13/400*10)=-1.62148837674627 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: SLC45A3 [Title/Abstract] AND EPB41L4B [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SLC45A3 [Title/Abstract] AND EPB41L4B [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SLC45A3(205628617)-EPB41L4B(112042201), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | SLC45A3-EPB41L4B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC45A3-EPB41L4B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SLC45A3-EPB41L4B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SLC45A3-EPB41L4B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | EPB41L4B | GO:0031032 | actomyosin structure organization | 22006950 |
Tgene | EPB41L4B | GO:0042060 | wound healing | 23664528 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:205628617/chr9:112042201) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000367145 | SLC45A3 | chr1 | 205630988 | - | ENST00000374566 | EPB41L4B | chr9 | 112042201 | - | 6496 | 1520 | 296 | 3916 | 1206 |
ENST00000367145 | SLC45A3 | chr1 | 205630988 | - | ENST00000374557 | EPB41L4B | chr9 | 112042201 | - | 4702 | 1520 | 296 | 2770 | 824 |
ENST00000367145 | SLC45A3 | chr1 | 205630989 | - | ENST00000374566 | EPB41L4B | chr9 | 112042201 | - | 6496 | 1520 | 296 | 3916 | 1206 |
ENST00000367145 | SLC45A3 | chr1 | 205630989 | - | ENST00000374557 | EPB41L4B | chr9 | 112042201 | - | 4702 | 1520 | 296 | 2770 | 824 |
ENST00000367145 | SLC45A3 | chr1 | 205630988 | - | ENST00000374566 | EPB41L4B | chr9 | 112042200 | - | 6496 | 1520 | 296 | 3916 | 1206 |
ENST00000367145 | SLC45A3 | chr1 | 205630988 | - | ENST00000374557 | EPB41L4B | chr9 | 112042200 | - | 4702 | 1520 | 296 | 2770 | 824 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000367145 | ENST00000374566 | SLC45A3 | chr1 | 205630988 | - | EPB41L4B | chr9 | 112042201 | - | 0.001029181 | 0.99897087 |
ENST00000367145 | ENST00000374557 | SLC45A3 | chr1 | 205630988 | - | EPB41L4B | chr9 | 112042201 | - | 0.003955982 | 0.99604404 |
ENST00000367145 | ENST00000374566 | SLC45A3 | chr1 | 205630989 | - | EPB41L4B | chr9 | 112042201 | - | 0.001029181 | 0.99897087 |
ENST00000367145 | ENST00000374557 | SLC45A3 | chr1 | 205630989 | - | EPB41L4B | chr9 | 112042201 | - | 0.003955982 | 0.99604404 |
ENST00000367145 | ENST00000374566 | SLC45A3 | chr1 | 205630988 | - | EPB41L4B | chr9 | 112042200 | - | 0.001029181 | 0.99897087 |
ENST00000367145 | ENST00000374557 | SLC45A3 | chr1 | 205630988 | - | EPB41L4B | chr9 | 112042200 | - | 0.003955982 | 0.99604404 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SLC45A3-EPB41L4B |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SLC45A3 | chr1 | 205630988 | EPB41L4B | chr9 | 112042200 | 1520 | 407 | LPYTLASLYHREKQKHAKGQDLFDQI |
SLC45A3 | chr1 | 205630988 | EPB41L4B | chr9 | 112042201 | 1520 | 407 | LPYTLASLYHREKQKHAKGQDLFDQI |
SLC45A3 | chr1 | 205630989 | EPB41L4B | chr9 | 112042201 | 1520 | 407 | LPYTLASLYHREKQKHAKGQDLFDQI |
Top |
Potential FusionNeoAntigen Information of SLC45A3-EPB41L4B in HLA I |
![]() |
SLC45A3-EPB41L4B_205630988_112042200.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SLC45A3-EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 1520 | HLA-B14:01 | YHREKQKHA | 0.9222 | 0.5219 | 8 | 17 |
SLC45A3-EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 1520 | HLA-B14:02 | YHREKQKHA | 0.9222 | 0.5219 | 8 | 17 |
SLC45A3-EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 1520 | HLA-B15:24 | KQKHAKGQDLF | 0.9999 | 0.826 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of SLC45A3-EPB41L4B in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SLC45A3-EPB41L4B |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8813 | SLYHREKQKHAKGQ | SLC45A3 | EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 1520 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SLC45A3-EPB41L4B |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8813 | SLYHREKQKHAKGQ | -4.62424 | -5.65954 |
HLA-B14:02 | 3BVN | 8813 | SLYHREKQKHAKGQ | -4.1114 | -4.2248 |
HLA-B52:01 | 3W39 | 8813 | SLYHREKQKHAKGQ | -6.8001 | -6.9135 |
HLA-B52:01 | 3W39 | 8813 | SLYHREKQKHAKGQ | -6.46104 | -7.49634 |
HLA-A24:02 | 5HGA | 8813 | SLYHREKQKHAKGQ | -9.1447 | -9.2581 |
HLA-A24:02 | 5HGA | 8813 | SLYHREKQKHAKGQ | -6.01279 | -7.04809 |
HLA-B44:05 | 3DX8 | 8813 | SLYHREKQKHAKGQ | -5.02862 | -5.14202 |
HLA-B44:05 | 3DX8 | 8813 | SLYHREKQKHAKGQ | -4.60714 | -5.64244 |
Top |
Vaccine Design for the FusionNeoAntigens of SLC45A3-EPB41L4B |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SLC45A3-EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 12 | 23 | KQKHAKGQDLF | CAGAAACATGCCAAAGGCCAGGATTTGTTTGAT |
SLC45A3-EPB41L4B | chr1 | 205630988 | chr9 | 112042200 | 8 | 17 | YHREKQKHA | CACCGGGAGAAGCAGAAACATGCCAAA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SLC45A3-EPB41L4B |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
PRAD | SLC45A3-EPB41L4B | chr1 | 205630988 | ENST00000367145 | chr9 | 112042200 | ENST00000374557 | TCGA-HC-7211-01A |
Top |
Potential target of CAR-T therapy development for SLC45A3-EPB41L4B |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 120_140 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D4 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 161_181 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D5 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 198_218 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D6 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 19_39 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D1 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 275_295 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D7 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 323_343 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D8 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 353_373 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D9 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 382_402 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D10 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 52_72 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D2 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042200 | ENST00000367145 | - | 4 | 5 | 88_108 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D3 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 120_140 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D4 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 161_181 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D5 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 198_218 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D6 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 19_39 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D1 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 275_295 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D7 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 323_343 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D8 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 353_373 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D9 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 382_402 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D10 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 52_72 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D2 |
Hgene | SLC45A3 | chr1:205630988 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 88_108 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D3 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 120_140 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D4 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 161_181 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D5 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 198_218 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D6 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 19_39 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D1 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 275_295 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D7 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 323_343 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D8 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 353_373 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D9 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 382_402 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D10 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 52_72 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D2 |
Hgene | SLC45A3 | chr1:205630989 | chr9:112042201 | ENST00000367145 | - | 4 | 5 | 88_108 | 408 | 554.0 | Transmembrane | Helical%3B Name%3D3 |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SLC45A3-EPB41L4B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SLC45A3-EPB41L4B |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |