Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SMARCA4-CARM1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SMARCA4-CARM1
	FusionPDB ID: 83886
	FusionGDB2.0 ID: 83886
		Hgene	Tgene
	Gene symbol	SMARCA4	CARM1
	Gene ID	6597	10498
	Gene name	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	coactivator associated arginine methyltransferase 1
	Synonyms	BAF190\|BAF190A\|BRG1\|CSS4\|MRD16\|RTPS2\|SNF2\|SNF2-beta\|SNF2L4\|SNF2LB\|SWI2\|hSNF2b	PRMT4
	Cytomap	19p13.2	19p13.2
	Type of gene	protein-coding	protein-coding
	Description	transcription activator BRG1ATP-dependent helicase SMARCA4BRG1-associated factor 190ABRM/SWI2-related gene 1SNF2-like 4brahma protein-like 1global transcription activator homologous sequencehomeotic gene regulatormitotic growth and transcription a	histone-arginine methyltransferase CARM1protein arginine N-methyltransferase 4
	Modification date	20200315	20200313
	UniProtAcc	.	Q86X55 Main function of 5'-partner protein: FUNCTION: Methylates (mono- and asymmetric dimethylation) the guanidino nitrogens of arginyl residues in several proteins involved in DNA packaging, transcription regulation, pre-mRNA splicing, and mRNA stability. Recruited to promoters upon gene activation together with histone acetyltransferases from EP300/P300 and p160 families, methylates histone H3 at 'Arg-17' (H3R17me), forming mainly asymmetric dimethylarginine (H3R17me2a), leading to activate transcription via chromatin remodeling. During nuclear hormone receptor activation and TCF7L2/TCF4 activation, acts synergically with EP300/P300 and either one of the p160 histone acetyltransferases NCOA1/SRC1, NCOA2/GRIP1 and NCOA3/ACTR or CTNNB1/beta-catenin to activate transcription. During myogenic transcriptional activation, acts together with NCOA3/ACTR as a coactivator for MEF2C. During monocyte inflammatory stimulation, acts together with EP300/P300 as a coactivator for NF-kappa-B. Acts as coactivator for PPARG, promotes adipocyte differentiation and the accumulation of brown fat tissue. Plays a role in the regulation of pre-mRNA alternative splicing by methylation of splicing factors. Also seems to be involved in p53/TP53 transcriptional activation. Methylates EP300/P300, both at 'Arg-2142', which may loosen its interaction with NCOA2/GRIP1, and at 'Arg-580' and 'Arg-604' in the KIX domain, which impairs its interaction with CREB and inhibits CREB-dependent transcriptional activation. Also methylates arginine residues in RNA-binding proteins PABPC1, ELAVL1 and ELAV4, which may affect their mRNA-stabilizing properties and the half-life of their target mRNAs. {ECO:0000269\|PubMed:16497732, ECO:0000269\|PubMed:19405910}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000344626, ENST00000358026, ENST00000429416, ENST00000444061, ENST00000541122, ENST00000589677, ENST00000413806, ENST00000450717, ENST00000590574, ENST00000538456,	ENST00000327064, ENST00000344150,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	29 X 29 X 17=14297	4 X 7 X 10=280
	# samples	55	12
	** MAII score	log2(55/14297*10)=-4.70013702309346 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(12/280*10)=-1.22239242133645 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SMARCA4 [Title/Abstract] AND CARM1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SMARCA4 [Title/Abstract] AND CARM1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SMARCA4(11071850)-CARM1(11015627), # samples:3 SMARCA4(11100119)-CARM1(11022860), # samples:3 CARM1(11031803)-SMARCA4(11172460), # samples:2
Anticipated loss of major functional domain due to fusion event.	SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. CARM1-SMARCA4 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. SMARCA4-CARM1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SMARCA4	GO:0006337	nucleosome disassembly	8895581
Hgene	SMARCA4	GO:0006338	chromatin remodeling	10943845\|11726552
Hgene	SMARCA4	GO:0045892	negative regulation of transcription, DNA-templated	12065415
Hgene	SMARCA4	GO:0045944	positive regulation of transcription by RNA polymerase II	15774904\|17938176
Hgene	SMARCA4	GO:0051091	positive regulation of DNA-binding transcription factor activity	11950834\|17938176
Hgene	SMARCA4	GO:1902661	positive regulation of glucose mediated signaling pathway	22368283
Tgene	CARM1	GO:0016571	histone methylation	19405910

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:11071850/chr19:11015627)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SMARCA4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CARM1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000358026	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6288	3666	263	5272	1669
ENST00000358026	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6168	3666	263	5203	1646
ENST00000344626	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6209	3587	184	5193	1669
ENST00000344626	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6089	3587	184	5124	1646
ENST00000429416	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6285	3663	56	5269	1737
ENST00000429416	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6165	3663	56	5200	1714
ENST00000541122	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6289	3667	255	5273	1672
ENST00000541122	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6169	3667	255	5204	1649
ENST00000589677	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6334	3712	309	5318	1669
ENST00000589677	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6214	3712	309	5249	1646
ENST00000444061	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6100	3478	66	5084	1672
ENST00000444061	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	5980	3478	66	5015	1649
ENST00000590574	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6441	3819	416	5425	1669
ENST00000590574	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	6321	3819	416	5356	1646
ENST00000413806	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6004	3382	0	4988	1662
ENST00000413806	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	5884	3382	0	4919	1639
ENST00000450717	SMARCA4	chr19	11138626	+	ENST00000327064	CARM1	chr19	11015627	+	6004	3382	0	4988	1662
ENST00000450717	SMARCA4	chr19	11138626	+	ENST00000344150	CARM1	chr19	11015627	+	5884	3382	0	4919	1639

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000358026	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.005076306	0.9949238
ENST00000358026	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00560685	0.9943931
ENST00000344626	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.005070199	0.99492973
ENST00000344626	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.005599104	0.9944009
ENST00000429416	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.005514389	0.99448556
ENST00000429416	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.006043121	0.9939568
ENST00000541122	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00565286	0.99434716
ENST00000541122	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.006143129	0.99385685
ENST00000589677	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00563148	0.9943685
ENST00000589677	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.006115088	0.99388486
ENST00000444061	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.004734719	0.99526525
ENST00000444061	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.005239988	0.99476
ENST00000590574	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00563739	0.9943626
ENST00000590574	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.006128463	0.99387157
ENST00000413806	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00432338	0.9956766
ENST00000413806	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.004794039	0.99520594
ENST00000450717	ENST00000327064	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.00432338	0.9956766
ENST00000450717	ENST00000344150	SMARCA4	chr19	11138626	+	CARM1	chr19	11015627	+	0.004794039	0.99520594

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SMARCA4-CARM1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3382	1125	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3478	1135	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3587	1132	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3663	17	AASLFREEKRDAHSAPGPARRGGGGA
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3666	1132	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3667	1135	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3712	1132	EDYFAYRGFKYLRLDDEDVCVFKCSV
SMARCA4	chr19	11138626	CARM1	chr19	11015627	3819	1132	EDYFAYRGFKYLRLDDEDVCVFKCSV

Top

Potential FusionNeoAntigen Information of SMARCA4-CARM1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SMARCA4-CARM1_11138626_11015627.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:30	RLDDEDVCV	0.982	0.5157	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:67	RLDDEDVCV	0.982	0.5157	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:24	RLDDEDVCV	0.982	0.5157	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:11	RLDDEDVCV	0.9789	0.5389	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:16	RLDDEDVCV	0.9665	0.5017	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:21	RLDDEDVCV	0.9572	0.6357	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:13	RLDDEDVCV	0.9418	0.6326	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:38	RLDDEDVCV	0.9163	0.6243	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:35	RLDDEDVCV	0.8659	0.5344	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:29	RLDDEDVCV	0.8391	0.519	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:20	RLDDEDVCV	0.808	0.5211	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:19	YLRLDDEDVCV	0.8897	0.5534	10	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C05:09	RLDDEDVCV	0.9992	0.9077	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:07	RLDDEDVCV	0.9822	0.5764	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:01	RLDDEDVCV	0.982	0.5157	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C08:15	RLDDEDVCV	0.9786	0.9482	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C05:09	RLDDEDVCVF	0.9999	0.8424	12	22
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C05:01	RLDDEDVCV	0.9992	0.9077	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C04:03	RLDDEDVCV	0.999	0.7378	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C08:02	RLDDEDVCV	0.9786	0.9482	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-A02:06	RLDDEDVCV	0.9572	0.6357	12	21
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C05:01	RLDDEDVCVF	0.9999	0.8424	12	22
SMARCA4-CARM1	chr19	11138626	chr19	11015627	3587	HLA-C04:03	RLDDEDVCVF	0.9999	0.6708	12	22

Top

Potential FusionNeoAntigen Information of SMARCA4-CARM1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SMARCA4-CARM1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7860	RGFKYLRLDDEDVC	SMARCA4	CARM1	chr19	11138626	chr19	11015627	3587

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMARCA4-CARM1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7860	RGFKYLRLDDEDVC	-7.15543	-7.26883
HLA-B14:02	3BVN	7860	RGFKYLRLDDEDVC	-4.77435	-5.80965
HLA-B52:01	3W39	7860	RGFKYLRLDDEDVC	-6.80875	-6.92215
HLA-B52:01	3W39	7860	RGFKYLRLDDEDVC	-4.20386	-5.23916
HLA-A11:01	4UQ2	7860	RGFKYLRLDDEDVC	-7.5194	-8.5547
HLA-A11:01	4UQ2	7860	RGFKYLRLDDEDVC	-6.9601	-7.0735
HLA-A24:02	5HGA	7860	RGFKYLRLDDEDVC	-7.52403	-7.63743
HLA-A24:02	5HGA	7860	RGFKYLRLDDEDVC	-5.82433	-6.85963
HLA-B27:05	6PYJ	7860	RGFKYLRLDDEDVC	-3.28285	-4.31815
HLA-B44:05	3DX8	7860	RGFKYLRLDDEDVC	-5.91172	-6.94702
HLA-B44:05	3DX8	7860	RGFKYLRLDDEDVC	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of SMARCA4-CARM1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SMARCA4-CARM1	chr19	11138626	chr19	11015627	10	21	YLRLDDEDVCV	GGCTTGATGATGAAGATGTGTGTGTCTTTAAGT
SMARCA4-CARM1	chr19	11138626	chr19	11015627	12	21	RLDDEDVCV	ATGATGAAGATGTGTGTGTCTTTAAGT
SMARCA4-CARM1	chr19	11138626	chr19	11015627	12	22	RLDDEDVCVF	ATGATGAAGATGTGTGTGTCTTTAAGTGCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SMARCA4-CARM1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	SMARCA4-CARM1	chr19	11138626	ENST00000344626	chr19	11015627	ENST00000327064	TCGA-CU-A5W6-01A

Top

Potential target of CAR-T therapy development for SMARCA4-CARM1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SMARCA4-CARM1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SMARCA4-CARM1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)