![]() |
|||||||
|
Fusion Protein:SON-CD44 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SON-CD44 | FusionPDB ID: 85154 | FusionGDB2.0 ID: 85154 | Hgene | Tgene | Gene symbol | SON | CD44 | Gene ID | 6651 | 960 |
Gene name | SON DNA and RNA binding protein | CD44 molecule (Indian blood group) | |
Synonyms | BASS1|C21orf50|DBP-5|NREBP|SON3|TOKIMS | CDW44|CSPG8|ECMR-III|HCELL|HUTCH-I|IN|LHR|MC56|MDU2|MDU3|MIC4|Pgp1 | |
Cytomap | 21q22.11 | 11p13 | |
Type of gene | protein-coding | protein-coding | |
Description | protein SONBax antagonist selected in Saccharomyces 1NRE-binding proteinSON DNA binding proteinnegative regulatory element-binding protein | CD44 antigenGP90 lymphocyte homing/adhesion receptorHermes antigenIndian blood group antigencell surface glycoprotein CD44chondroitin sulfate proteoglycan 8epicanextracellular matrix receptor IIIhematopoietic cell E- and L-selectin ligandheparan | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | SHH Main function of 5'-partner protein: 462 | P16070 Main function of 5'-partner protein: FUNCTION: Cell-surface receptor that plays a role in cell-cell interactions, cell adhesion and migration, helping them to sense and respond to changes in the tissue microenvironment (PubMed:16541107, PubMed:19703720, PubMed:22726066). Participates thereby in a wide variety of cellular functions including the activation, recirculation and homing of T-lymphocytes, hematopoiesis, inflammation and response to bacterial infection (PubMed:7528188). Engages, through its ectodomain, extracellular matrix components such as hyaluronan/HA, collagen, growth factors, cytokines or proteases and serves as a platform for signal transduction by assembling, via its cytoplasmic domain, protein complexes containing receptor kinases and membrane proteases (PubMed:18757307, PubMed:23589287). Such effectors include PKN2, the RhoGTPases RAC1 and RHOA, Rho-kinases and phospholipase C that coordinate signaling pathways promoting calcium mobilization and actin-mediated cytoskeleton reorganization essential for cell migration and adhesion (PubMed:15123640). {ECO:0000269|PubMed:15123640, ECO:0000269|PubMed:16541107, ECO:0000269|PubMed:18757307, ECO:0000269|PubMed:19703720, ECO:0000269|PubMed:22726066, ECO:0000269|PubMed:23589287, ECO:0000269|PubMed:7528188}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000290239, ENST00000300278, ENST00000356577, ENST00000381679, ENST00000381692, ENST00000470533, | ENST00000278386, ENST00000352818, ENST00000360158, ENST00000415148, ENST00000428726, ENST00000433354, ENST00000433892, ENST00000434472, ENST00000437706, ENST00000449691, ENST00000526025, ENST00000526669, ENST00000528922, ENST00000263398, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 12 X 5=720 | 12 X 14 X 4=672 |
# samples | 16 | 16 | |
** MAII score | log2(16/720*10)=-2.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(16/672*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: SON [Title/Abstract] AND CD44 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SON [Title/Abstract] AND CD44 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SON(34929527)-CD44(35250784), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | SON-CD44 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SON-CD44 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SON-CD44 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SON-CD44 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | SON | GO:0006397 | mRNA processing | 21504830 |
Hgene | SON | GO:0043066 | negative regulation of apoptotic process | 10509013 |
Hgene | SON | GO:0048024 | regulation of mRNA splicing, via spliceosome | 21504830 |
Tgene | CD44 | GO:0007155 | cell adhesion | 19703720 |
Tgene | CD44 | GO:0016477 | cell migration | 22726066 |
Tgene | CD44 | GO:0030214 | hyaluronan catabolic process | 17170110 |
Tgene | CD44 | GO:0033138 | positive regulation of peptidyl-serine phosphorylation | 17045821 |
Tgene | CD44 | GO:0042110 | T cell activation | 7528188 |
Tgene | CD44 | GO:0043518 | negative regulation of DNA damage response, signal transduction by p53 class mediator | 17045821 |
Tgene | CD44 | GO:0044344 | cellular response to fibroblast growth factor stimulus | 19577615 |
Tgene | CD44 | GO:0050731 | positive regulation of peptidyl-tyrosine phosphorylation | 17045821 |
Tgene | CD44 | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 17045821 |
Tgene | CD44 | GO:1902166 | negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 17045821 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr21:34929527/chr11:35250784) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000356577 | SON | chr21 | 34929527 | - | ENST00000263398 | CD44 | chr11 | 35250784 | + | 9895 | 6730 | 475 | 6825 | 2116 |
ENST00000290239 | SON | chr21 | 34929527 | - | ENST00000263398 | CD44 | chr11 | 35250784 | + | 9469 | 6304 | 49 | 6399 | 2116 |
ENST00000381692 | SON | chr21 | 34929527 | - | ENST00000263398 | CD44 | chr11 | 35250784 | + | 3545 | 380 | 41 | 475 | 144 |
ENST00000300278 | SON | chr21 | 34929527 | - | ENST00000263398 | CD44 | chr11 | 35250784 | + | 9449 | 6284 | 29 | 6379 | 2116 |
ENST00000381679 | SON | chr21 | 34929527 | - | ENST00000263398 | CD44 | chr11 | 35250784 | + | 9448 | 6283 | 28 | 6378 | 2116 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000356577 | ENST00000263398 | SON | chr21 | 34929527 | - | CD44 | chr11 | 35250784 | + | 0.00062958 | 0.9993704 |
ENST00000290239 | ENST00000263398 | SON | chr21 | 34929527 | - | CD44 | chr11 | 35250784 | + | 0.000387543 | 0.9996125 |
ENST00000381692 | ENST00000263398 | SON | chr21 | 34929527 | - | CD44 | chr11 | 35250784 | + | 0.004993781 | 0.9950062 |
ENST00000300278 | ENST00000263398 | SON | chr21 | 34929527 | - | CD44 | chr11 | 35250784 | + | 0.00037403 | 0.9996259 |
ENST00000381679 | ENST00000263398 | SON | chr21 | 34929527 | - | CD44 | chr11 | 35250784 | + | 0.000373846 | 0.99962616 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SON-CD44 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SON | chr21 | 34929527 | CD44 | chr11 | 35250784 | 380 | 113 | KKSGGATIEELTELVNKESSETPDQF |
SON | chr21 | 34929527 | CD44 | chr11 | 35250784 | 6283 | 2085 | KKSGGATIEELTELVNKESSETPDQF |
SON | chr21 | 34929527 | CD44 | chr11 | 35250784 | 6284 | 2085 | KKSGGATIEELTELVNKESSETPDQF |
SON | chr21 | 34929527 | CD44 | chr11 | 35250784 | 6304 | 2085 | KKSGGATIEELTELVNKESSETPDQF |
SON | chr21 | 34929527 | CD44 | chr11 | 35250784 | 6730 | 2085 | KKSGGATIEELTELVNKESSETPDQF |
Top |
Potential FusionNeoAntigen Information of SON-CD44 in HLA I |
![]() |
SON-CD44_34929527_35250784.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B15:17 | ATIEELTEL | 0.9929 | 0.9723 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B46:01 | ATIEELTEL | 0.9925 | 0.6524 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B15:16 | ATIEELTEL | 0.9901 | 0.9222 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:38 | ATIEELTEL | 0.9827 | 0.7486 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:22 | ATIEELTEL | 0.9824 | 0.5122 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:35 | ATIEELTEL | 0.9757 | 0.5921 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:21 | ATIEELTEL | 0.9754 | 0.7028 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:24 | ATIEELTEL | 0.9679 | 0.5493 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:67 | ATIEELTEL | 0.9679 | 0.5493 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:30 | ATIEELTEL | 0.9679 | 0.5493 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:60 | ATIEELTEL | 0.9673 | 0.537 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:29 | ATIEELTEL | 0.9644 | 0.5542 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:11 | ATIEELTEL | 0.9624 | 0.6057 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:20 | ATIEELTEL | 0.9616 | 0.5512 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:04 | ATIEELTEL | 0.9542 | 0.5868 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:27 | ATIEELTEL | 0.9501 | 0.6321 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:16 | ATIEELTEL | 0.9496 | 0.5514 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:13 | ATIEELTEL | 0.9496 | 0.7331 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B13:01 | ATIEELTEL | 0.3936 | 0.9807 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:21 | ATIEELTELV | 0.9841 | 0.6885 | 5 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:20 | ATIEELTELV | 0.9778 | 0.5508 | 5 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:15 | TIEELTEL | 1 | 0.9901 | 6 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:07 | ATIEELTEL | 0.9998 | 0.9889 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:19 | ATIEELTEL | 0.9998 | 0.9942 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C15:06 | ATIEELTEL | 0.9997 | 0.9587 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C15:04 | ATIEELTEL | 0.9997 | 0.9492 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:08 | ATIEELTEL | 0.9997 | 0.9561 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C04:06 | ATIEELTEL | 0.9995 | 0.93 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C06:03 | ATIEELTEL | 0.9991 | 0.9949 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C12:04 | ATIEELTEL | 0.999 | 0.9937 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C12:12 | ATIEELTEL | 0.999 | 0.9631 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:04 | ATIEELTEL | 0.9975 | 0.9746 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:13 | ATIEELTEL | 0.9975 | 0.9746 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C01:17 | ATIEELTEL | 0.9877 | 0.9627 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:03 | ATIEELTEL | 0.9738 | 0.9911 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:07 | ATIEELTEL | 0.972 | 0.5866 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C07:13 | ATIEELTEL | 0.9693 | 0.9622 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:01 | ATIEELTEL | 0.9679 | 0.5493 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:14 | ATIEELTEL | 0.961 | 0.9825 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C07:29 | ATIEELTEL | 0.9585 | 0.9545 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C02:06 | ATIEELTEL | 0.8959 | 0.9767 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C01:30 | ATIEELTEL | 0.8081 | 0.9675 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:02 | TIEELTEL | 1 | 0.9901 | 6 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:04 | ATIEELTEL | 0.9997 | 0.9918 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:03 | ATIEELTEL | 0.9997 | 0.9918 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C15:09 | ATIEELTEL | 0.9997 | 0.9492 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C15:05 | ATIEELTEL | 0.9997 | 0.9596 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C15:02 | ATIEELTEL | 0.9996 | 0.9496 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:17 | ATIEELTEL | 0.9995 | 0.9822 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:05 | ATIEELTEL | 0.9994 | 0.9519 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C12:02 | ATIEELTEL | 0.9994 | 0.9785 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C12:03 | ATIEELTEL | 0.9994 | 0.9826 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:02 | ATIEELTEL | 0.9993 | 0.9858 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C16:04 | ATIEELTEL | 0.9993 | 0.9863 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C03:06 | ATIEELTEL | 0.9989 | 0.9937 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C04:03 | ATIEELTEL | 0.9982 | 0.8187 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C16:02 | ATIEELTEL | 0.997 | 0.9936 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C16:01 | ATIEELTEL | 0.9956 | 0.9845 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C01:03 | ATIEELTEL | 0.9909 | 0.9443 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B57:02 | ATIEELTEL | 0.99 | 0.9272 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C01:02 | ATIEELTEL | 0.9871 | 0.961 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A25:01 | ATIEELTEL | 0.9801 | 0.9515 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:14 | ATIEELTEL | 0.9761 | 0.5846 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:06 | ATIEELTEL | 0.9754 | 0.7028 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C08:01 | ATIEELTEL | 0.9738 | 0.9911 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:03 | ATIEELTEL | 0.9702 | 0.6828 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A68:02 | ATIEELTEL | 0.9691 | 0.648 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B15:73 | ATIEELTEL | 0.9593 | 0.9807 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A69:01 | ATIEELTEL | 0.9526 | 0.7424 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B15:30 | ATIEELTEL | 0.9111 | 0.9333 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B35:13 | ATIEELTEL | 0.8964 | 0.9574 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C02:10 | ATIEELTEL | 0.8803 | 0.9817 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C02:02 | ATIEELTEL | 0.8803 | 0.9817 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-C17:01 | ATIEELTEL | 0.8647 | 0.9614 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A69:01 | TIEELTELV | 0.7377 | 0.8318 | 6 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-B07:13 | ATIEELTEL | 0.4807 | 0.8627 | 5 | 14 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A68:02 | ATIEELTELV | 0.9927 | 0.7975 | 5 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:14 | ATIEELTELV | 0.9846 | 0.592 | 5 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A02:06 | ATIEELTELV | 0.9841 | 0.6885 | 5 | 15 |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 | HLA-A69:01 | ATIEELTELV | 0.9833 | 0.7284 | 5 | 15 |
Top |
Potential FusionNeoAntigen Information of SON-CD44 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SON-CD44 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9398 | TIEELTELVNKESS | SON | CD44 | chr21 | 34929527 | chr11 | 35250784 | 6304 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SON-CD44 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9398 | TIEELTELVNKESS | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9398 | TIEELTELVNKESS | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9398 | TIEELTELVNKESS | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9398 | TIEELTELVNKESS | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9398 | TIEELTELVNKESS | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9398 | TIEELTELVNKESS | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9398 | TIEELTELVNKESS | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9398 | TIEELTELVNKESS | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9398 | TIEELTELVNKESS | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9398 | TIEELTELVNKESS | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9398 | TIEELTELVNKESS | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of SON-CD44 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 5 | 14 | ATIEELTEL | GCTACTATAGAAGAACTAACTGAGTTG |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 5 | 15 | ATIEELTELV | GCTACTATAGAAGAACTAACTGAGTTGGTG |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6 | 14 | TIEELTEL | ACTATAGAAGAACTAACTGAGTTG |
SON-CD44 | chr21 | 34929527 | chr11 | 35250784 | 6 | 15 | TIEELTELV | ACTATAGAAGAACTAACTGAGTTGGTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SON-CD44 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
N/A | SON-CD44 | chr21 | 34929527 | ENST00000290239 | chr11 | 35250784 | ENST00000263398 | BE695450 |
Top |
Potential target of CAR-T therapy development for SON-CD44 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000263398 | 0 | 9 | 650_670 | 0 | 362.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000278386 | 0 | 4 | 650_670 | 0 | 140.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000352818 | 0 | 8 | 650_670 | 0 | 341.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000360158 | 0 | 10 | 650_670 | 0 | 397.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000415148 | 0 | 17 | 650_670 | 0 | 700.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000428726 | 0 | 18 | 650_670 | 0 | 743.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000433892 | 0 | 12 | 650_670 | 0 | 494.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000434472 | 0 | 10 | 650_670 | 0 | 430.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000437706 | 0 | 17 | 650_670 | 0 | 675.0 | Transmembrane | Helical | |
Tgene | CD44 | chr21:34929527 | chr11:35250784 | ENST00000449691 | 0 | 17 | 650_670 | 0 | 700.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SON-CD44 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SON-CD44 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |