Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:B2M-TFF1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: B2M-TFF1
	FusionPDB ID: 8650
	FusionGDB2.0 ID: 8650
		Hgene	Tgene
	Gene symbol	B2M	TFF1
	Gene ID	567	7031
	Gene name	beta-2-microglobulin	trefoil factor 1
	Synonyms	IMD43	BCEI\|D21S21\|HP1.A\|HPS2\|pNR-2\|pS2
	Cytomap	15q21.1	21q22.3
	Type of gene	protein-coding	protein-coding
	Description	beta-2-microglobulinbeta chain of MHC class I moleculesbeta-2-microglobin	trefoil factor 1breast cancer estrogen-inducible proteinbreast cancer estrogen-inducible sequencegastrointestinal trefoil protein pS2polypeptide P1.Aprotein pS2
	Modification date	20200329	20200313
	UniProtAcc	P61769 Main function of 5'-partner protein: FUNCTION: Component of the class I major histocompatibility complex (MHC). Involved in the presentation of peptide antigens to the immune system. Exogenously applied M.tuberculosis EsxA or EsxA-EsxB (or EsxA expressed in host) binds B2M and decreases its export to the cell surface (total protein levels do not change), probably leading to defects in class I antigen presentation (PubMed:25356553). {ECO:0000269\|PubMed:25356553}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000544417, ENST00000558401, ENST00000559916, ENST00000559220,	ENST00000291527,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	32 X 24 X 12=9216	4 X 3 X 3=36
	# samples	43	5
	** MAII score	log2(43/9216*10)=-4.42173215185285 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/36*10)=0.473931188332412 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: B2M [Title/Abstract] AND TFF1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: B2M [Title/Abstract] AND TFF1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	B2M(45003811)-TFF1(43783516), # samples:1
Anticipated loss of major functional domain due to fusion event.	B2M-TFF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. B2M-TFF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. B2M-TFF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. B2M-TFF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	B2M	GO:0002726	positive regulation of T cell cytokine production	24643698
Hgene	B2M	GO:0007611	learning or memory	26147761
Hgene	B2M	GO:0050680	negative regulation of epithelial cell proliferation	28213472
Hgene	B2M	GO:0050768	negative regulation of neurogenesis	26147761
Hgene	B2M	GO:0090647	modulation of age-related behavioral decline	26147761
Hgene	B2M	GO:1900121	negative regulation of receptor binding	9465039
Hgene	B2M	GO:1990000	amyloid fibril formation	28468825
Hgene	B2M	GO:2000774	positive regulation of cellular senescence	28213472
Hgene	B2M	GO:2000978	negative regulation of forebrain neuron differentiation	26147761

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:45003811/chr21:43783516)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across B2M (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TFF1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000558401	B2M	chr15	45003811	+	ENST00000291527	TFF1	chr21	43783516	-	504	137	31	306	91
ENST00000559916	B2M	chr15	45003811	+	ENST00000291527	TFF1	chr21	43783516	-	468	101	56	301	81
ENST00000544417	B2M	chr15	45003811	+	ENST00000291527	TFF1	chr21	43783516	-	464	97	52	297	81

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000558401	ENST00000291527	B2M	chr15	45003811	+	TFF1	chr21	43783516	-	0.45230708	0.5476929
ENST00000559916	ENST00000291527	B2M	chr15	45003811	+	TFF1	chr21	43783516	-	0.5070437	0.49295628
ENST00000544417	ENST00000291527	B2M	chr15	45003811	+	TFF1	chr21	43783516	-	0.4813628	0.51863724

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for B2M-TFF1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
B2M	chr15	45003811	TFF1	chr21	43783516	101	15	SRYSLFLAWRLSSRRVQWPPVKDRIV
B2M	chr15	45003811	TFF1	chr21	43783516	137	14	AGIPEADSIRAEMSRSVALAVLALLS
B2M	chr15	45003811	TFF1	chr21	43783516	97	15	SRYSLFLAWRLSSRRVQWPPVKDRIV

Top

Potential FusionNeoAntigen Information of B2M-TFF1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

B2M-TFF1_45003811_43783516.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:02	AEMSRSVA	0.9998	0.7772	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B45:01	AEMSRSVA	0.9998	0.9735	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:01	LSSRRVQW	0.9996	0.9771	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:01	EMSRSVAL	0.9995	0.8582	11	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:09	EMSRSVAL	0.9994	0.8199	11	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:02	LSSRRVQW	0.9986	0.9445	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:01	LSSRRVQW	0.9959	0.9631	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B41:01	AEMSRSVA	0.993	0.9506	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:01	AEMSRSVA	0.8299	0.7808	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B27:04	IRAEMSRSV	0.9991	0.5558	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B13:01	AEMSRSVAL	0.998	0.9323	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:01	IRAEMSRSV	0.9977	0.7217	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:02	IRAEMSRSV	0.9977	0.7217	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:02	AEMSRSVAL	0.9967	0.7129	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:02	AEMSRSVAL	0.9963	0.7161	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:01	AEMSRSVAL	0.9963	0.7161	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B44:03	AEMSRSVAL	0.9956	0.9748	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:01	RLSSRRVQW	0.9933	0.9841	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:06	IRAEMSRSV	0.9932	0.7764	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A30:08	MSRSVALAV	0.9929	0.8223	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:24	IRAEMSRSV	0.992	0.5251	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A31:08	RLSSRRVQW	0.9905	0.6478	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B45:01	AEMSRSVAL	0.9897	0.9645	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:01	AEMSRSVAL	0.9828	0.7947	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:01	RLSSRRVQW	0.9825	0.96	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A32:13	RLSSRRVQW	0.9806	0.9262	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:02	RLSSRRVQW	0.9803	0.9324	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:11	FLAWRLSSR	0.9662	0.8964	5	14
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:03	FLAWRLSSR	0.9662	0.8964	5	14
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:09	FLAWRLSSR	0.9662	0.8964	5	14
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:09	AEMSRSVAL	0.944	0.8097	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B41:01	AEMSRSVAL	0.9012	0.9709	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A31:02	FLAWRLSSR	0.894	0.89	5	14
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:01	AEMSRSVAL	0.8913	0.8461	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:13	AEMSRSVAL	0.8881	0.8682	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:01	AEMSRSVAL	0.8746	0.6599	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:03	AEMSRSVAL	0.8677	0.6588	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:16	MSRSVALAV	0.861	0.9341	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:37	AEMSRSVAL	0.7722	0.5049	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:01	AEMSRSVAL	0.7032	0.7263	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B27:05	SRRVQWPPVK	0.999	0.6241	12	22
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B45:01	AEMSRSVALA	0.9971	0.9594	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:02	AEMSRSVALA	0.9956	0.7776	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B48:01	RAEMSRSVAL	0.9799	0.6091	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B41:01	AEMSRSVALA	0.9512	0.962	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:01	AEMSRSVALA	0.8781	0.7675	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:13	RAEMSRSVAL	0.8019	0.9155	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B45:01	AEMSRSVALAV	0.9998	0.9638	10	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A68:24	EADSIRAEMSR	0.9991	0.575	4	15
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A68:03	EADSIRAEMSR	0.9988	0.5453	4	15
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:02	IRAEMSRSVAL	0.9986	0.8042	8	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:01	IRAEMSRSVAL	0.9986	0.8042	8	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A68:05	EADSIRAEMSR	0.9973	0.5614	4	15
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A68:08	EADSIRAEMSR	0.9957	0.5298	4	15
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:11	SLFLAWRLSSR	0.9603	0.915	3	14
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:03	SLFLAWRLSSR	0.9603	0.915	3	14
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:09	SLFLAWRLSSR	0.9603	0.915	3	14
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B40:06	AEMSRSVA	0.9999	0.7515	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:03	EMSRSVAL	0.9735	0.8789	11	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B40:06	AEMSRSVAL	0.9996	0.7028	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B44:10	AEMSRSVAL	0.9989	0.6936	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C15:06	MSRSVALAV	0.9979	0.8612	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C12:04	MSRSVALAV	0.9973	0.9868	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C06:03	MSRSVALAV	0.9968	0.9895	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C12:12	MSRSVALAV	0.9942	0.9502	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B73:01	IRAEMSRSV	0.9925	0.6967	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B42:02	AEMSRSVAL	0.9887	0.8148	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:12	IRAEMSRSV	0.9862	0.8767	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B14:03	AEMSRSVAL	0.9783	0.8553	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:05	IRAEMSRSV	0.9646	0.9567	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:08	AEMSRSVAL	0.9643	0.9158	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:27	IRAEMSRSV	0.9399	0.9305	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:95	IRAEMSRSV	0.9307	0.6885	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:09	AEMSRSVAL	0.9225	0.6688	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B78:01	MSRSVALAV	0.9044	0.7696	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:12	AEMSRSVAL	0.8753	0.8438	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:05	AEMSRSVAL	0.8681	0.821	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:29	IRAEMSRSV	0.8615	0.9103	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:10	IRAEMSRSV	0.7958	0.9478	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:67	IRAEMSRSV	0.7931	0.9255	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:80	IRAEMSRSV	0.7931	0.9255	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:19	IRAEMSRSV	0.7919	0.7332	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:46	IRAEMSRSV	0.7871	0.8619	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:13	IRAEMSRSV	0.7418	0.9048	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B44:08	RLSSRRVQW	0.1202	0.6731	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C12:16	IRAEMSRSV	0.003	0.939	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B27:14	SRRVQWPPVK	0.9985	0.559	12	22
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B40:06	AEMSRSVALA	0.9971	0.7103	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:08	RAEMSRSVAL	0.9786	0.9565	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A68:01	EADSIRAEMSR	0.9991	0.575	4	15
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:12	IRAEMSRSVAL	0.9989	0.9246	8	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:10	LSSRRVQW	0.9996	0.9771	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:18	EMSRSVAL	0.9995	0.8582	11	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:04	LSSRRVQW	0.9989	0.768	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:06	LSSRRVQW	0.9981	0.9619	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:12	EMSRSVAL	0.993	0.8935	11	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:04	AEMSRSVA	0.8299	0.7808	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:05	AEMSRSVA	0.8299	0.7808	10	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B40:04	AEMSRSVAL	0.9996	0.7387	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B27:06	IRAEMSRSV	0.9993	0.5996	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B27:09	IRAEMSRSV	0.9992	0.6393	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C15:02	MSRSVALAV	0.9988	0.8443	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B44:13	AEMSRSVAL	0.9956	0.9748	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B44:07	AEMSRSVAL	0.9956	0.9748	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B44:26	AEMSRSVAL	0.9956	0.9748	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A32:01	RLSSRRVQW	0.9953	0.928	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-A30:01	MSRSVALAV	0.9937	0.9255	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:10	RLSSRRVQW	0.9933	0.9841	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C12:03	MSRSVALAV	0.9923	0.9738	12	21
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:18	AEMSRSVAL	0.9828	0.7947	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B08:12	AEMSRSVAL	0.9802	0.8753	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:04	RLSSRRVQW	0.9801	0.7706	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C06:08	IRAEMSRSV	0.9792	0.9703	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B58:06	RLSSRRVQW	0.9726	0.9351	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B41:03	AEMSRSVAL	0.9689	0.723	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:01	FLAWRLSSR	0.9662	0.8964	5	14
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:11	AEMSRSVAL	0.9582	0.8977	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:01	IRAEMSRSV	0.9458	0.61	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:04	AEMSRSVAL	0.9173	0.6798	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:07	AEMSRSVAL	0.9104	0.6219	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:02	AEMSRSVAL	0.8965	0.8722	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:31	AEMSRSVAL	0.8936	0.8419	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:06	AEMSRSVAL	0.8825	0.6774	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:08	AEMSRSVAL	0.8812	0.6701	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:05	AEMSRSVAL	0.8746	0.6599	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:03	AEMSRSVAL	0.8624	0.6476	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B15:24	RLSSRRVQW	0.8504	0.9205	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B18:11	AEMSRSVAL	0.8479	0.6925	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:17	IRAEMSRSV	0.8376	0.9509	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:73	AEMSRSVAL	0.7943	0.77	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:02	IRAEMSRSV	0.7931	0.9255	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:30	AEMSRSVAL	0.7737	0.8106	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:68	AEMSRSVAL	0.7615	0.5457	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B48:02	AEMSRSVAL	0.7494	0.8426	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:54	AEMSRSVAL	0.7362	0.7021	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B15:13	RLSSRRVQW	0.7234	0.7756	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:05	AEMSRSVAL	0.7032	0.7263	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:04	AEMSRSVAL	0.7032	0.7263	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:09	AEMSRSVAL	0.6979	0.5881	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B57:02	RLSSRRVQW	0.6647	0.9208	9	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:04	IRAEMSRSV	0.6079	0.9633	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C07:22	IRAEMSRSV	0.5626	0.7169	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B15:53	AEMSRSVAL	0.5606	0.7334	10	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C06:06	IRAEMSRSV	0.309	0.9814	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C06:02	IRAEMSRSV	0.0798	0.9778	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-C06:17	IRAEMSRSV	0.0798	0.9778	8	17
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-B27:10	SRRVQWPPVK	0.9986	0.7085	12	22
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B07:13	RAEMSRSVAL	0.9981	0.8184	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B39:02	RAEMSRSVAL	0.9072	0.9126	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:04	AEMSRSVALA	0.8781	0.7675	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B50:05	AEMSRSVALA	0.8781	0.7675	10	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B41:03	RAEMSRSVAL	0.7773	0.7038	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B40:04	RAEMSRSVAL	0.7592	0.7398	9	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	HLA-B27:06	IRAEMSRSVAL	0.9999	0.6543	8	19
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A30:01	SSRRVQWPPVK	0.9971	0.7311	11	22
B2M-TFF1	chr15	45003811	chr21	43783516	97	HLA-A74:01	SLFLAWRLSSR	0.9603	0.915	3	14

Top

Potential FusionNeoAntigen Information of B2M-TFF1 in HLA II

B2M-TFF1_45003811_43783516.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0102	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0103	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0103	EADSIRAEMSRSVAL	4	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0109	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0115	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0123	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-0123	EADSIRAEMSRSVAL	4	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-1525	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-1525	EADSIRAEMSRSVAL	4	19
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-1525	PEADSIRAEMSRSVA	3	18
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-1615	ADSIRAEMSRSVALA	5	20
B2M-TFF1	chr15	45003811	chr21	43783516	137	DRB1-1615	EADSIRAEMSRSVAL	4	19

Top

Fusion breakpoint peptide structures of B2M-TFF1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1404	DSIRAEMSRSVALA	B2M	TFF1	chr15	45003811	chr21	43783516	137

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4802	LAWRLSSRRVQWPP	B2M	TFF1	chr15	45003811	chr21	43783516	97

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of B2M-TFF1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1404	DSIRAEMSRSVALA	-7.9962	-8.1096
HLA-B14:02	3BVN	1404	DSIRAEMSRSVALA	-5.70842	-6.74372
HLA-B52:01	3W39	1404	DSIRAEMSRSVALA	-6.83737	-6.95077
HLA-B52:01	3W39	1404	DSIRAEMSRSVALA	-4.4836	-5.5189
HLA-A11:01	4UQ2	1404	DSIRAEMSRSVALA	-10.0067	-10.1201
HLA-A11:01	4UQ2	1404	DSIRAEMSRSVALA	-9.03915	-10.0745
HLA-A24:02	5HGA	1404	DSIRAEMSRSVALA	-6.56204	-6.67544
HLA-A24:02	5HGA	1404	DSIRAEMSRSVALA	-5.42271	-6.45801
HLA-B44:05	3DX8	1404	DSIRAEMSRSVALA	-7.85648	-8.89178
HLA-B44:05	3DX8	1404	DSIRAEMSRSVALA	-5.3978	-5.5112
HLA-A02:01	6TDR	1404	DSIRAEMSRSVALA	-3.37154	-4.40684
HLA-B14:02	3BVN	4802	LAWRLSSRRVQWPP	-6.40088	-6.51428
HLA-B14:02	3BVN	4802	LAWRLSSRRVQWPP	-4.97542	-6.01072
HLA-B52:01	3W39	4802	LAWRLSSRRVQWPP	-7.36623	-7.47963
HLA-B52:01	3W39	4802	LAWRLSSRRVQWPP	-4.98012	-6.01542
HLA-A11:01	4UQ2	4802	LAWRLSSRRVQWPP	-6.80131	-7.83661
HLA-A24:02	5HGA	4802	LAWRLSSRRVQWPP	-6.33543	-6.44883
HLA-A24:02	5HGA	4802	LAWRLSSRRVQWPP	-5.28835	-6.32365
HLA-B44:05	3DX8	4802	LAWRLSSRRVQWPP	-5.38591	-5.49931
HLA-B44:05	3DX8	4802	LAWRLSSRRVQWPP	-3.67288	-4.70818

Top

Vaccine Design for the FusionNeoAntigens of B2M-TFF1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
B2M-TFF1	chr15	45003811	chr21	43783516	10	18	AEMSRSVA	CTATCCAGCAGACGTGTACAGTGG
B2M-TFF1	chr15	45003811	chr21	43783516	10	18	LSSRRVQW	CTATCCAGCAGACGTGTACAGTGG
B2M-TFF1	chr15	45003811	chr21	43783516	10	19	AEMSRSVAL	CTATCCAGCAGACGTGTACAGTGGCCC
B2M-TFF1	chr15	45003811	chr21	43783516	10	20	AEMSRSVALA	CTATCCAGCAGACGTGTACAGTGGCCCCCC
B2M-TFF1	chr15	45003811	chr21	43783516	10	21	AEMSRSVALAV	CTATCCAGCAGACGTGTACAGTGGCCCCCCGTG
B2M-TFF1	chr15	45003811	chr21	43783516	11	19	EMSRSVAL	TCCAGCAGACGTGTACAGTGGCCC
B2M-TFF1	chr15	45003811	chr21	43783516	11	22	SSRRVQWPPVK	TCCAGCAGACGTGTACAGTGGCCCCCCGTGAAA
B2M-TFF1	chr15	45003811	chr21	43783516	12	21	MSRSVALAV	AGCAGACGTGTACAGTGGCCCCCCGTG
B2M-TFF1	chr15	45003811	chr21	43783516	12	22	SRRVQWPPVK	AGCAGACGTGTACAGTGGCCCCCCGTGAAA
B2M-TFF1	chr15	45003811	chr21	43783516	3	14	SLFLAWRLSSR	TCTCTCTTTCTGGCCTGGAGGCTATCCAGCAGA
B2M-TFF1	chr15	45003811	chr21	43783516	4	15	EADSIRAEMSR	CTCTTTCTGGCCTGGAGGCTATCCAGCAGACGT
B2M-TFF1	chr15	45003811	chr21	43783516	5	14	FLAWRLSSR	TTTCTGGCCTGGAGGCTATCCAGCAGA
B2M-TFF1	chr15	45003811	chr21	43783516	8	17	IRAEMSRSV	TGGAGGCTATCCAGCAGACGTGTACAG
B2M-TFF1	chr15	45003811	chr21	43783516	8	19	IRAEMSRSVAL	TGGAGGCTATCCAGCAGACGTGTACAGTGGCCC
B2M-TFF1	chr15	45003811	chr21	43783516	9	18	RLSSRRVQW	AGGCTATCCAGCAGACGTGTACAGTGG
B2M-TFF1	chr15	45003811	chr21	43783516	9	19	RAEMSRSVAL	AGGCTATCCAGCAGACGTGTACAGTGGCCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
B2M-TFF1	chr15	45003811	chr21	43783516	3	18	PEADSIRAEMSRSVA	TCTCTCTTTCTGGCCTGGAGGCTATCCAGCAGACGTGTACAGTGG
B2M-TFF1	chr15	45003811	chr21	43783516	4	19	EADSIRAEMSRSVAL	CTCTTTCTGGCCTGGAGGCTATCCAGCAGACGTGTACAGTGGCCC
B2M-TFF1	chr15	45003811	chr21	43783516	5	20	ADSIRAEMSRSVALA	TTTCTGGCCTGGAGGCTATCCAGCAGACGTGTACAGTGGCCCCCC

Top

Information of the samples that have these potential fusion neoantigens of B2M-TFF1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	B2M-TFF1	chr15	45003811	ENST00000544417	chr21	43783516	ENST00000291527	179N
Non-Cancer	B2M-TFF1	chr15	45003811	ENST00000558401	chr21	43783516	ENST00000291527	179N

Top

Potential target of CAR-T therapy development for B2M-TFF1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to B2M-TFF1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to B2M-TFF1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)