Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:STK10-SH3PXD2B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: STK10-SH3PXD2B
	FusionPDB ID: 87438
	FusionGDB2.0 ID: 87438
		Hgene	Tgene
	Gene symbol	STK10	SH3PXD2B
	Gene ID	6793	285590
	Gene name	serine/threonine kinase 10	SH3 and PX domains 2B
	Synonyms	LOK\|PRO2729	FAD49\|FTHS\|HOFI\|KIAA1295\|TKS4\|TSK4
	Cytomap	5q35.1	5q35.1
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase 10lymphocyte-oriented kinase	SH3 and PX domain-containing protein 2Badapter protein HOFIadaptor protein HOFIfactor for adipocyte differentiation 49tyrosine kinase substrate with four SH3 domains
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000176763, ENST00000517775,	ENST00000523651, ENST00000311601, ENST00000519643,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	9 X 11 X 6=594	5 X 5 X 4=100
	# samples	13	6
	** MAII score	log2(13/594*10)=-2.19195130777231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/100*10)=-0.736965594166206 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: STK10 [Title/Abstract] AND SH3PXD2B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: STK10 [Title/Abstract] AND SH3PXD2B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	STK10(171583628)-SH3PXD2B(171849500), # samples:3
Anticipated loss of major functional domain due to fusion event.	STK10-SH3PXD2B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. STK10-SH3PXD2B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. STK10-SH3PXD2B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. STK10-SH3PXD2B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	STK10	GO:0046777	protein autophosphorylation	12639966\|18239682
Tgene	SH3PXD2B	GO:0006801	superoxide metabolic process	19755710
Tgene	SH3PXD2B	GO:0072657	protein localization to membrane	19755710

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:171583628/chr5:171849500)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across STK10 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SH3PXD2B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000176763	STK10	chr5	171583628	-	ENST00000519643	SH3PXD2B	chr5	171849500	-	1978	665	26	1882	618
ENST00000176763	STK10	chr5	171583628	-	ENST00000311601	SH3PXD2B	chr5	171849500	-	8196	665	26	3325	1099

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000176763	ENST00000519643	STK10	chr5	171583628	-	SH3PXD2B	chr5	171849500	-	0.002213562	0.9977864
ENST00000176763	ENST00000311601	STK10	chr5	171583628	-	SH3PXD2B	chr5	171849500	-	0.000656842	0.9993431

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for STK10-SH3PXD2B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
STK10	chr5	171583628	SH3PXD2B	chr5	171849500	665	213	KLLGAYYHDGKLWVYIIRVTWSSGST

Top

Potential FusionNeoAntigen Information of STK10-SH3PXD2B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

STK10-SH3PXD2B_171583628_171849500.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:01	YHDGKLWV	0.999	0.9468	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:01	YHDGKLWV	0.999	0.8445	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-A02:21	KLWVYIIRV	0.9904	0.5186	10	19
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B57:01	WVYIIRVTW	0.9899	0.9841	12	21
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-A32:13	WVYIIRVTW	0.9538	0.9732	12	21
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B35:08	YHDGKLWVY	0.821	0.7269	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:01	YHDGKLWVY	0.7896	0.7165	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:10	YHDGKLWVY	0.7669	0.5839	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:02	YHDGKLWVY	0.7413	0.7016	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:18	YHDGKLWVY	0.7029	0.6641	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:01	YHDGKLWVY	0.6474	0.5969	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:03	YHDGKLWVY	0.5559	0.7124	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:37	YHDGKLWVY	0.4509	0.6036	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:01	YHDGKLWVY	0.3734	0.8145	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B14:01	YHDGKLWVY	0.2029	0.6007	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B14:02	YHDGKLWVY	0.2029	0.6007	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B47:01	YHDGKLWVY	0.0761	0.5143	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:01	YHDGKLWVYI	0.9977	0.6213	6	16
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:02	YHDGKLWVYI	0.9976	0.6135	6	16
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:18	YYHDGKLWVY	0.8538	0.5288	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:01	YHDGKLWVYII	0.9997	0.558	6	17
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:09	YHDGKLWV	0.9992	0.7372	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:05	YHDGKLWV	0.9987	0.8299	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:07	YHDGKLWVY	0.9615	0.6157	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:10	YHDGKLWVY	0.9614	0.6208	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:27	YHDGKLWVY	0.7797	0.7944	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:05	YHDGKLWVY	0.744	0.7635	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:21	YHDGKLWVY	0.7336	0.8444	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:29	YHDGKLWVY	0.71	0.6865	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:80	YHDGKLWVY	0.7079	0.8251	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:67	YHDGKLWVY	0.7079	0.8251	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:12	YHDGKLWVY	0.665	0.6009	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:13	YHDGKLWVY	0.6316	0.7077	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:10	YHDGKLWVY	0.6298	0.8402	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:46	YHDGKLWVY	0.6235	0.6484	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C03:14	YHDGKLWVY	0.5702	0.891	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:05	YHDGKLWVY	0.5662	0.581	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:14	YYHDGKLWV	0.2598	0.9065	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:05	YYHDGKLWV	0.241	0.9256	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:14	YHDGKLWVY	0.2375	0.6172	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:67	YYHDGKLWV	0.1991	0.9689	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:80	YYHDGKLWV	0.1991	0.9689	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:19	YYHDGKLWV	0.162	0.832	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B14:03	YHDGKLWVY	0.1589	0.5264	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C12:16	YYHDGKLWV	0.1571	0.9627	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:10	YYHDGKLWV	0.1296	0.9723	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:46	YYHDGKLWV	0.1109	0.9317	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:13	YYHDGKLWV	0.1065	0.9434	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:29	YYHDGKLWV	0.1002	0.94	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:95	YYHDGKLWV	0.0776	0.7179	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:27	YYHDGKLWV	0.0761	0.9486	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C12:16	YHDGKLWVY	0.0195	0.9044	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C12:16	YYHDGKLWVY	0.99	0.8854	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:21	YYHDGKLWVY	0.9768	0.8277	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:10	YYHDGKLWVY	0.9671	0.8603	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:67	YYHDGKLWVY	0.9667	0.8424	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:80	YYHDGKLWVY	0.9667	0.8424	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:27	YYHDGKLWVY	0.9622	0.8101	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:46	YYHDGKLWVY	0.955	0.6628	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:05	YYHDGKLWVY	0.8838	0.7739	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C18:01	YHDGKLWV	0.9998	0.8476	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:05	YHDGKLWV	0.999	0.9468	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:11	YHDGKLWV	0.9933	0.7206	6	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-A02:06	KLWVYIIRV	0.9904	0.5186	10	19
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B57:10	WVYIIRVTW	0.9899	0.9841	12	21
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:01	YHDGKLWVY	0.9615	0.6157	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-A32:01	WVYIIRVTW	0.9463	0.967	12	21
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C18:01	YHDGKLWVY	0.941	0.6506	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B35:20	YHDGKLWVY	0.9262	0.8563	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B48:02	YHDGKLWVY	0.8425	0.829	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:11	YHDGKLWVY	0.8409	0.8058	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:05	YHDGKLWVY	0.7896	0.7165	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:17	YHDGKLWVY	0.7511	0.9293	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:02	YHDGKLWVY	0.7079	0.8251	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:04	YHDGKLWVY	0.6202	0.8453	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B39:31	YHDGKLWVY	0.6177	0.5983	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C18:01	YYHDGKLWV	0.495	0.8432	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:03	YHDGKLWVY	0.4821	0.7979	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:07	YHDGKLWVY	0.4243	0.7717	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:06	YHDGKLWVY	0.404	0.7711	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C03:67	YHDGKLWVY	0.403	0.8837	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:17	YYHDGKLWV	0.3924	0.9933	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:02	YYHDGKLWV	0.3924	0.9933	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:08	YHDGKLWVY	0.3851	0.5878	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B18:05	YHDGKLWVY	0.3734	0.8145	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:02	YHDGKLWVY	0.3699	0.8564	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:03	YHDGKLWVY	0.3699	0.8564	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:06	YHDGKLWVY	0.3647	0.9318	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:04	YHDGKLWVY	0.3642	0.6111	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C04:04	YYHDGKLWV	0.3631	0.9558	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B15:09	YHDGKLWVY	0.3258	0.5854	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:04	YHDGKLWVY	0.3154	0.7779	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C03:67	YYHDGKLWV	0.2406	0.9934	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:06	YYHDGKLWV	0.2039	0.9873	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:02	YYHDGKLWV	0.1991	0.9689	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:02	YYHDGKLWV	0.1649	0.9712	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:03	YYHDGKLWV	0.1649	0.9712	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:22	YYHDGKLWV	0.1125	0.7143	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:17	YYHDGKLWV	0.0943	0.9774	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:04	YYHDGKLWV	0.0653	0.9662	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:01	YYHDGKLWV	0.0647	0.7216	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:08	YHDGKLWVY	0.0097	0.9313	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:08	YYHDGKLWV	0.0062	0.9928	5	14
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:02	YHDGKLWVY	0.0038	0.9375	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:17	YHDGKLWVY	0.0038	0.9375	6	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:05	YHDGKLWVYI	0.9977	0.6213	6	16
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:02	YYHDGKLWVY	0.9667	0.8424	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C07:17	YYHDGKLWVY	0.9597	0.9343	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C06:06	YYHDGKLWVY	0.8904	0.9441	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:02	YYHDGKLWVY	0.8205	0.8586	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-C14:03	YYHDGKLWVY	0.8205	0.8586	5	15
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-B38:05	YHDGKLWVYII	0.9997	0.558	6	17
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	665	HLA-A32:01	KLWVYIIRVTW	0.9847	0.9934	10	21

Top

Potential FusionNeoAntigen Information of STK10-SH3PXD2B in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of STK10-SH3PXD2B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10662	YHDGKLWVYIIRVT	STK10	SH3PXD2B	chr5	171583628	chr5	171849500	665

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of STK10-SH3PXD2B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10662	YHDGKLWVYIIRVT	-7.4838	-7.5956
HLA-B14:02	3BVN	10662	YHDGKLWVYIIRVT	-3.16066	-4.20376
HLA-B52:01	3W39	10662	YHDGKLWVYIIRVT	-6.93679	-7.04859
HLA-B52:01	3W39	10662	YHDGKLWVYIIRVT	-6.10064	-7.14374
HLA-A11:01	4UQ2	10662	YHDGKLWVYIIRVT	-7.21307	-7.32487
HLA-A24:02	5HGA	10662	YHDGKLWVYIIRVT	-6.56769	-6.67949
HLA-A24:02	5HGA	10662	YHDGKLWVYIIRVT	-4.65311	-5.69621
HLA-B44:05	3DX8	10662	YHDGKLWVYIIRVT	-6.68002	-6.79182
HLA-B44:05	3DX8	10662	YHDGKLWVYIIRVT	-3.22493	-4.26803

Top

Vaccine Design for the FusionNeoAntigens of STK10-SH3PXD2B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	10	19	KLWVYIIRV	AAGCTGTGGGTCTACATCATCCGGGTC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	10	21	KLWVYIIRVTW	AAGCTGTGGGTCTACATCATCCGGGTCACGTGG
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	12	21	WVYIIRVTW	TGGGTCTACATCATCCGGGTCACGTGG
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	5	14	YYHDGKLWV	TACTATCACGACGGGAAGCTGTGGGTC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	5	15	YYHDGKLWVY	TACTATCACGACGGGAAGCTGTGGGTCTAC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	6	14	YHDGKLWV	TATCACGACGGGAAGCTGTGGGTC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	6	15	YHDGKLWVY	TATCACGACGGGAAGCTGTGGGTCTAC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	6	16	YHDGKLWVYI	TATCACGACGGGAAGCTGTGGGTCTACATC
STK10-SH3PXD2B	chr5	171583628	chr5	171849500	6	17	YHDGKLWVYII	TATCACGACGGGAAGCTGTGGGTCTACATCATC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of STK10-SH3PXD2B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	STK10-SH3PXD2B	chr5	171583628	ENST00000176763	chr5	171849500	ENST00000311601	TCGA-BH-A18T-01A

Top

Potential target of CAR-T therapy development for STK10-SH3PXD2B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to STK10-SH3PXD2B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to STK10-SH3PXD2B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)