Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SULT1C2-ACVR1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SULT1C2-ACVR1
	FusionPDB ID: 88057
	FusionGDB2.0 ID: 88057
		Hgene	Tgene
	Gene symbol	SULT1C2	ACVR1
	Gene ID	27233	90
	Gene name	sulfotransferase family 1C member 4	activin A receptor type 1
	Synonyms	SULT1C\|SULT1C2	ACTRI\|ACVR1A\|ACVRLK2\|ALK2\|FOP\|SKR1\|TSRI
	Cytomap	2q12.3	2q24.1
	Type of gene	protein-coding	protein-coding
	Description	sulfotransferase 1C4ST1C4SULT1C#2sulfotransferase 1C2sulfotransferase family, cytosolic, 1C, member 2sulfotransferase family, cytosolic, 1C, member 4sulfotransferase family, cytosolic, 1C, member C2	activin receptor type-1TGF-B superfamily receptor type Iactivin A receptor, type Iactivin A receptor, type II-like kinase 2activin receptor type Iactivin receptor-like kinase 2hydroxyalkyl-protein kinaseserine/threonine-protein kinase receptor R1
	Modification date	20200313	20200320
	UniProtAcc	.	Q8NER5 Main function of 5'-partner protein: FUNCTION: Serine/threonine protein kinase which forms a receptor complex on ligand binding. The receptor complex consisting of 2 type II and 2 type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators, SMAD2 and SMAD3. Receptor for activin AB, activin B and NODAL. Plays a role in cell differentiation, growth arrest and apoptosis. {ECO:0000269\|PubMed:12063393, ECO:0000269\|PubMed:15531507}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000251481, ENST00000326853, ENST00000409880, ENST00000437390, ENST00000492554,	ENST00000487456, ENST00000263640, ENST00000409283, ENST00000410057, ENST00000434821,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 1 X 2=6	5 X 5 X 3=75
	# samples	3	5
	** MAII score	log2(3/6*10)=2.32192809488736	log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SULT1C2 [Title/Abstract] AND ACVR1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SULT1C2 [Title/Abstract] AND ACVR1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SULT1C2(108910810)-ACVR1(158622708), # samples:1
Anticipated loss of major functional domain due to fusion event.	SULT1C2-ACVR1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SULT1C2-ACVR1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SULT1C2	GO:0006068	ethanol catabolic process	23207770
Hgene	SULT1C2	GO:0050427	3'-phosphoadenosine 5'-phosphosulfate metabolic process	23207770
Hgene	SULT1C2	GO:0051923	sulfation	20056724\|23207770
Tgene	ACVR1	GO:0006468	protein phosphorylation	12065756\|19506109
Tgene	ACVR1	GO:0007179	transforming growth factor beta receptor signaling pathway	8242742
Tgene	ACVR1	GO:0010862	positive regulation of pathway-restricted SMAD protein phosphorylation	19506109
Tgene	ACVR1	GO:0018107	peptidyl-threonine phosphorylation	19736306
Tgene	ACVR1	GO:0030509	BMP signaling pathway	18436533
Tgene	ACVR1	GO:0032924	activin receptor signaling pathway	19506109
Tgene	ACVR1	GO:0045893	positive regulation of transcription, DNA-templated	8242742
Tgene	ACVR1	GO:0045944	positive regulation of transcription by RNA polymerase II	19506109
Tgene	ACVR1	GO:0060389	pathway-restricted SMAD protein phosphorylation	19736306
Tgene	ACVR1	GO:2000017	positive regulation of determination of dorsal identity	19506109

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:108910810/chr2:158622708)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SULT1C2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ACVR1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000251481	SULT1C2	chr2	108910810	+	ENST00000263640	ACVR1	chr2	158622708	-	2555	730	453	1469	338
ENST00000251481	SULT1C2	chr2	108910810	+	ENST00000409283	ACVR1	chr2	158622708	-	2552	730	453	1469	338
ENST00000251481	SULT1C2	chr2	108910810	+	ENST00000434821	ACVR1	chr2	158622708	-	2552	730	453	1469	338
ENST00000251481	SULT1C2	chr2	108910810	+	ENST00000410057	ACVR1	chr2	158622708	-	1685	730	453	1469	338
ENST00000326853	SULT1C2	chr2	108910810	+	ENST00000263640	ACVR1	chr2	158622708	-	2555	730	453	1469	338
ENST00000326853	SULT1C2	chr2	108910810	+	ENST00000409283	ACVR1	chr2	158622708	-	2552	730	453	1469	338
ENST00000326853	SULT1C2	chr2	108910810	+	ENST00000434821	ACVR1	chr2	158622708	-	2552	730	453	1469	338
ENST00000326853	SULT1C2	chr2	108910810	+	ENST00000410057	ACVR1	chr2	158622708	-	1685	730	453	1469	338
ENST00000437390	SULT1C2	chr2	108910810	+	ENST00000263640	ACVR1	chr2	158622708	-	2279	454	177	1193	338
ENST00000437390	SULT1C2	chr2	108910810	+	ENST00000409283	ACVR1	chr2	158622708	-	2276	454	177	1193	338
ENST00000437390	SULT1C2	chr2	108910810	+	ENST00000434821	ACVR1	chr2	158622708	-	2276	454	177	1193	338
ENST00000437390	SULT1C2	chr2	108910810	+	ENST00000410057	ACVR1	chr2	158622708	-	1409	454	177	1193	338
ENST00000409880	SULT1C2	chr2	108910810	+	ENST00000263640	ACVR1	chr2	158622708	-	2279	454	177	1193	338
ENST00000409880	SULT1C2	chr2	108910810	+	ENST00000409283	ACVR1	chr2	158622708	-	2276	454	177	1193	338
ENST00000409880	SULT1C2	chr2	108910810	+	ENST00000434821	ACVR1	chr2	158622708	-	2276	454	177	1193	338
ENST00000409880	SULT1C2	chr2	108910810	+	ENST00000410057	ACVR1	chr2	158622708	-	1409	454	177	1193	338

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000251481	ENST00000263640	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000749113	0.9992508
ENST00000251481	ENST00000409283	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000752877	0.9992472
ENST00000251481	ENST00000434821	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000752877	0.9992472
ENST00000251481	ENST00000410057	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.003235574	0.9967644
ENST00000326853	ENST00000263640	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000749113	0.9992508
ENST00000326853	ENST00000409283	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000752877	0.9992472
ENST00000326853	ENST00000434821	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000752877	0.9992472
ENST00000326853	ENST00000410057	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.003235574	0.9967644
ENST00000437390	ENST00000263640	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000667841	0.99933213
ENST00000437390	ENST00000409283	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000674281	0.99932575
ENST00000437390	ENST00000434821	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000674281	0.99932575
ENST00000437390	ENST00000410057	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.003823417	0.9961766
ENST00000409880	ENST00000263640	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000667841	0.99933213
ENST00000409880	ENST00000409283	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000674281	0.99932575
ENST00000409880	ENST00000434821	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.000674281	0.99932575
ENST00000409880	ENST00000410057	SULT1C2	chr2	108910810	+	ACVR1	chr2	158622708	-	0.003823417	0.9961766

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SULT1C2-ACVR1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SULT1C2	chr2	108910810	ACVR1	chr2	158622708	454	92	HPFIEWARPPQPSGFIASDMTSRHSS
SULT1C2	chr2	108910810	ACVR1	chr2	158622708	730	92	HPFIEWARPPQPSGFIASDMTSRHSS

Top

Potential FusionNeoAntigen Information of SULT1C2-ACVR1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SULT1C2-ACVR1_108910810_158622708.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:05	RPPQPSGF	0.9827	0.5907	7	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:02	RPPQPSGF	0.982	0.6221	7	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B27:04	ARPPQPSGF	0.9981	0.5921	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B27:07	ARPPQPSGF	0.9888	0.5107	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:05	RPPQPSGFI	0.9883	0.5403	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:02	RPPQPSGFI	0.988	0.573	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B15:18	ARPPQPSGF	0.5414	0.6764	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:10	ARPPQPSGF	0.1218	0.6934	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B82:01	RPPQPSGFI	0.016	0.5169	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B46:01	WARPPQPSGF	0.9995	0.5967	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B82:01	QPSGFIASDM	0.3305	0.7537	10	20
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B81:01	QPSGFIASDM	0.2754	0.7742	10	20
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:12	RPPQPSGF	0.9386	0.7093	7	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:95	ARPPQPSGF	0.9817	0.702	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:05	ARPPQPSGF	0.9724	0.9562	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:27	ARPPQPSGF	0.9191	0.9574	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:29	ARPPQPSGF	0.8814	0.9325	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:12	RPPQPSGFI	0.8224	0.6926	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:19	ARPPQPSGF	0.806	0.8657	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:13	ARPPQPSGF	0.8057	0.9383	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:46	ARPPQPSGF	0.7692	0.9348	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:10	ARPPQPSGF	0.769	0.9669	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:67	ARPPQPSGF	0.7687	0.967	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:80	ARPPQPSGF	0.7687	0.967	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:04	RPPQPSGFI	0.6322	0.5207	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C12:16	ARPPQPSGF	0.1086	0.9715	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B42:01	RPPQPSGFI	0.1042	0.7241	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C12:12	WARPPQPSGF	0.995	0.9593	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:22	RPPQPSGF	0.982	0.6221	7	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:09	RPPQPSGF	0.9792	0.6145	7	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B27:10	ARPPQPSGF	0.998	0.6518	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B27:06	ARPPQPSGF	0.9977	0.6057	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B07:22	RPPQPSGFI	0.988	0.573	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:01	ARPPQPSGF	0.9877	0.7187	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:17	ARPPQPSGF	0.9227	0.9746	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:22	ARPPQPSGF	0.8236	0.763	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:02	ARPPQPSGF	0.7687	0.967	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C06:08	ARPPQPSGF	0.7483	0.9909	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C07:04	ARPPQPSGF	0.4705	0.9612	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C06:06	ARPPQPSGF	0.3881	0.9914	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C03:67	ARPPQPSGF	0.3575	0.9687	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C18:01	ARPPQPSGF	0.21	0.9462	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B15:68	ARPPQPSGF	0.097	0.759	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C06:17	ARPPQPSGF	0.0259	0.9939	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C06:02	ARPPQPSGF	0.0259	0.9939	6	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B82:02	RPPQPSGFI	0.016	0.5169	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C01:02	RPPQPSGFI	0.0055	0.9544	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C01:03	RPPQPSGFI	0.005	0.9365	7	16
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C03:02	WARPPQPSGF	0.999	0.9802	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B15:11	WARPPQPSGF	0.9989	0.8929	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B15:08	WARPPQPSGF	0.9986	0.8673	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B35:43	WARPPQPSGF	0.9983	0.8691	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C12:02	WARPPQPSGF	0.9978	0.9829	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C02:02	WARPPQPSGF	0.9939	0.9819	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-C02:10	WARPPQPSGF	0.9939	0.9819	5	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B55:04	QPSGFIASDM	0.4269	0.6808	10	20
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B82:02	QPSGFIASDM	0.3305	0.7537	10	20
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	HLA-B67:01	QPSGFIASDM	0.3048	0.9781	10	20

Top

Potential FusionNeoAntigen Information of SULT1C2-ACVR1 in HLA II

SULT1C2-ACVR1_108910810_158622708.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	DRB1-0422	PSGFIASDMTSRHSS	11	26
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	DRB1-0422	QPSGFIASDMTSRHS	10	25
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	DRB1-1111	HPFIEWARPPQPSGF	0	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	DRB1-1169	HPFIEWARPPQPSGF	0	15
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	730	DRB1-1363	HPFIEWARPPQPSGF	0	15

Top

Fusion breakpoint peptide structures of SULT1C2-ACVR1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
558	ARPPQPSGFIASDM	SULT1C2	ACVR1	chr2	108910810	chr2	158622708	730

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SULT1C2-ACVR1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	558	ARPPQPSGFIASDM	-7.02924	-7.14264
HLA-B14:02	3BVN	558	ARPPQPSGFIASDM	-3.38077	-4.41607
HLA-B52:01	3W39	558	ARPPQPSGFIASDM	-6.41355	-6.52695
HLA-B52:01	3W39	558	ARPPQPSGFIASDM	-4.44188	-5.47718
HLA-A24:02	5HGA	558	ARPPQPSGFIASDM	-7.76595	-8.80125
HLA-A24:02	5HGA	558	ARPPQPSGFIASDM	-7.30892	-7.42232
HLA-B44:05	3DX8	558	ARPPQPSGFIASDM	-5.65486	-5.76826
HLA-B44:05	3DX8	558	ARPPQPSGFIASDM	-2.95775	-3.99305

Top

Vaccine Design for the FusionNeoAntigens of SULT1C2-ACVR1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	10	20	QPSGFIASDM	AACCTTCTGGTTTCATTGCTTCAGACATGA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	5	15	WARPPQPSGF	GGGCTCGGCCACCCCAACCTTCTGGTTTCA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	6	15	ARPPQPSGF	CTCGGCCACCCCAACCTTCTGGTTTCA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	7	15	RPPQPSGF	GGCCACCCCAACCTTCTGGTTTCA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	7	16	RPPQPSGFI	GGCCACCCCAACCTTCTGGTTTCATTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	0	15	HPFIEWARPPQPSGF	ATCCTTTCATTGAGTGGGCTCGGCCACCCCAACCTTCTGGTTTCA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	10	25	QPSGFIASDMTSRHS	AACCTTCTGGTTTCATTGCTTCAGACATGACATCAAGACACTCCA
SULT1C2-ACVR1	chr2	108910810	chr2	158622708	11	26	PSGFIASDMTSRHSS	CTTCTGGTTTCATTGCTTCAGACATGACATCAAGACACTCCAGTA

Top

Information of the samples that have these potential fusion neoantigens of SULT1C2-ACVR1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	SULT1C2-ACVR1	chr2	108910810	ENST00000251481	chr2	158622708	ENST00000263640	61N

Top

Potential target of CAR-T therapy development for SULT1C2-ACVR1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SULT1C2-ACVR1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SULT1C2-ACVR1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)