![]() |
|||||||
|
Fusion Protein:SYNE1-CACNA1C |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SYNE1-CACNA1C | FusionPDB ID: 88402 | FusionGDB2.0 ID: 88402 | Hgene | Tgene | Gene symbol | SYNE1 | CACNA1C | Gene ID | 23345 | 775 |
Gene name | spectrin repeat containing nuclear envelope protein 1 | calcium voltage-gated channel subunit alpha1 C | |
Synonyms | 8B|AMCM|ARCA1|C6orf98|CPG2|EDMD4|KASH1|MYNE1|Nesp1|SCAR8|dJ45H2.2 | CACH2|CACN2|CACNL1A1|CCHL1A1|CaV1.2|LQT8|TS|TS. LQT8 | |
Cytomap | 6q25.2 | 12p13.33 | |
Type of gene | protein-coding | protein-coding | |
Description | nesprin-1CPG2 full lengthKASH domain-containing protein 1enaptinmyocyte nuclear envelope protein 1nesprin 1spectrin repeat containing, nuclear envelope 1synaptic nuclear envelope protein 1synaptic nuclei expressed gene 1 | voltage-dependent L-type calcium channel subunit alpha-1CDHPR, alpha-1 subunitcalcium channel, L type, alpha-1 polypeptide, isoform 1, cardiac musclecalcium channel, cardic dihydropyridine-sensitive, alpha-1 subunitcalcium channel, voltage-dependent, | |
Modification date | 20200320 | 20200315 | |
UniProtAcc | . | Q13936 Main function of 5'-partner protein: FUNCTION: Pore-forming, alpha-1C subunit of the voltage-gated calcium channel that gives rise to L-type calcium currents (PubMed:8392192, PubMed:7737988, PubMed:9087614, PubMed:9013606, PubMed:9607315, PubMed:12176756, PubMed:17071743, PubMed:11741969, PubMed:8099908, PubMed:12181424, PubMed:29078335, PubMed:29742403, PubMed:16299511, PubMed:20953164, PubMed:15454078, PubMed:15863612, PubMed:17224476, PubMed:24728418, PubMed:26253506, PubMed:27218670, PubMed:23677916). Mediates influx of calcium ions into the cytoplasm, and thereby triggers calcium release from the sarcoplasm (By similarity). Plays an important role in excitation-contraction coupling in the heart. Required for normal heart development and normal regulation of heart rhythm (PubMed:15454078, PubMed:15863612, PubMed:17224476, PubMed:24728418, PubMed:26253506). Required for normal contraction of smooth muscle cells in blood vessels and in the intestine. Essential for normal blood pressure regulation via its role in the contraction of arterial smooth muscle cells (PubMed:28119464). Long-lasting (L-type) calcium channels belong to the 'high-voltage activated' (HVA) group (Probable). {ECO:0000250|UniProtKB:P15381, ECO:0000269|PubMed:11741969, ECO:0000269|PubMed:12176756, ECO:0000269|PubMed:12181424, ECO:0000269|PubMed:15454078, ECO:0000269|PubMed:15863612, ECO:0000269|PubMed:16299511, ECO:0000269|PubMed:17071743, ECO:0000269|PubMed:17224476, ECO:0000269|PubMed:20953164, ECO:0000269|PubMed:23677916, ECO:0000269|PubMed:24728418, ECO:0000269|PubMed:26253506, ECO:0000269|PubMed:27218670, ECO:0000269|PubMed:28119464, ECO:0000269|PubMed:29078335, ECO:0000269|PubMed:29742403, ECO:0000269|PubMed:7737988, ECO:0000269|PubMed:8099908, ECO:0000269|PubMed:8392192, ECO:0000269|PubMed:9013606, ECO:0000269|PubMed:9087614, ECO:0000269|PubMed:9607315, ECO:0000305}.; FUNCTION: (Microbial infection) Acts as a receptor for Influenzavirus (PubMed:29779930). May play a critical role in allowing virus entry when sialylated and expressed on lung tissues (PubMed:29779930). {ECO:0000269|PubMed:29779930}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000265368, ENST00000341594, ENST00000356820, ENST00000367255, ENST00000423061, ENST00000448038, ENST00000347037, ENST00000354674, ENST00000367248, ENST00000367253, ENST00000413186, ENST00000466159, ENST00000495090, ENST00000539504, | ENST00000327702, ENST00000344100, ENST00000347598, ENST00000399591, ENST00000399595, ENST00000399597, ENST00000399601, ENST00000399603, ENST00000399606, ENST00000399617, ENST00000399621, ENST00000399629, ENST00000399634, ENST00000399637, ENST00000399638, ENST00000399641, ENST00000399644, ENST00000399649, ENST00000402845, ENST00000406454, ENST00000480911, ENST00000491104, ENST00000335762, ENST00000399655, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 13 X 15 X 6=1170 | 21 X 20 X 10=4200 |
# samples | 14 | 24 | |
** MAII score | log2(14/1170*10)=-3.0630097975258 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(24/4200*10)=-4.12928301694497 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: SYNE1 [Title/Abstract] AND CACNA1C [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SYNE1 [Title/Abstract] AND CACNA1C [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SYNE1(152614723)-CACNA1C(2778099), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | SYNE1-CACNA1C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNE1-CACNA1C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNE1-CACNA1C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SYNE1-CACNA1C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SYNE1-CACNA1C seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SYNE1-CACNA1C seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | SYNE1 | GO:0007030 | Golgi organization | 12808039 |
Hgene | SYNE1 | GO:0042692 | muscle cell differentiation | 11792814 |
Hgene | SYNE1 | GO:0090286 | cytoskeletal anchoring at nuclear membrane | 18396275 |
Hgene | SYNE1 | GO:0090292 | nuclear matrix anchoring at nuclear membrane | 11801724 |
Tgene | CACNA1C | GO:0007204 | positive regulation of cytosolic calcium ion concentration | 12130699 |
Tgene | CACNA1C | GO:0061577 | calcium ion transmembrane transport via high voltage-gated calcium channel | 15454078 |
Tgene | CACNA1C | GO:0070588 | calcium ion transmembrane transport | 15454078 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:152614723/chr12:2778099) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000367255 | SYNE1 | chr6 | 152614723 | - | ENST00000335762 | CACNA1C | chr12 | 2778099 | + | 20619 | 18614 | 602 | 20407 | 6601 |
ENST00000367255 | SYNE1 | chr6 | 152614723 | - | ENST00000399655 | CACNA1C | chr12 | 2778099 | + | 22151 | 18614 | 602 | 20407 | 6601 |
ENST00000356820 | SYNE1 | chr6 | 152614723 | - | ENST00000335762 | CACNA1C | chr12 | 2778099 | + | 3709 | 1704 | 66 | 3497 | 1143 |
ENST00000356820 | SYNE1 | chr6 | 152614723 | - | ENST00000399655 | CACNA1C | chr12 | 2778099 | + | 5241 | 1704 | 66 | 3497 | 1143 |
ENST00000448038 | SYNE1 | chr6 | 152614723 | - | ENST00000335762 | CACNA1C | chr12 | 2778099 | + | 20406 | 18401 | 602 | 20194 | 6530 |
ENST00000448038 | SYNE1 | chr6 | 152614723 | - | ENST00000399655 | CACNA1C | chr12 | 2778099 | + | 21938 | 18401 | 602 | 20194 | 6530 |
ENST00000341594 | SYNE1 | chr6 | 152614723 | - | ENST00000335762 | CACNA1C | chr12 | 2778099 | + | 19455 | 17450 | 602 | 19243 | 6213 |
ENST00000341594 | SYNE1 | chr6 | 152614723 | - | ENST00000399655 | CACNA1C | chr12 | 2778099 | + | 20987 | 17450 | 602 | 19243 | 6213 |
ENST00000265368 | SYNE1 | chr6 | 152614723 | - | ENST00000335762 | CACNA1C | chr12 | 2778099 | + | 20619 | 18614 | 602 | 20407 | 6601 |
ENST00000265368 | SYNE1 | chr6 | 152614723 | - | ENST00000399655 | CACNA1C | chr12 | 2778099 | + | 22151 | 18614 | 602 | 20407 | 6601 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000367255 | ENST00000335762 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.007499372 | 0.9925006 |
ENST00000367255 | ENST00000399655 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.005535417 | 0.9944646 |
ENST00000356820 | ENST00000335762 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.008958329 | 0.9910417 |
ENST00000356820 | ENST00000399655 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.002318349 | 0.9976816 |
ENST00000448038 | ENST00000335762 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.007577026 | 0.992423 |
ENST00000448038 | ENST00000399655 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.005597219 | 0.9944028 |
ENST00000341594 | ENST00000335762 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.007103205 | 0.99289685 |
ENST00000341594 | ENST00000399655 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.005177683 | 0.99482226 |
ENST00000265368 | ENST00000335762 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.007587784 | 0.99241215 |
ENST00000265368 | ENST00000399655 | SYNE1 | chr6 | 152614723 | - | CACNA1C | chr12 | 2778099 | + | 0.005611958 | 0.99438804 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SYNE1-CACNA1C |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SYNE1 | chr6 | 152614723 | CACNA1C | chr12 | 2778099 | 1704 | 545 | EPGRSPESQMAEHQRLVSMNMPLNSD |
SYNE1 | chr6 | 152614723 | CACNA1C | chr12 | 2778099 | 17450 | 5615 | EPGRSPESQMAEHQRLVSMNMPLNSD |
SYNE1 | chr6 | 152614723 | CACNA1C | chr12 | 2778099 | 18401 | 5932 | EPGRSPESQMAEHQRLVSMNMPLNSD |
SYNE1 | chr6 | 152614723 | CACNA1C | chr12 | 2778099 | 18614 | 6003 | EPGRSPESQMAEHQRLVSMNMPLNSD |
Top |
Potential FusionNeoAntigen Information of SYNE1-CACNA1C in HLA I |
![]() |
SYNE1-CACNA1C_152614723_2778099.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:01 | EHQRLVSM | 0.9997 | 0.5321 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:02 | EHQRLVSM | 0.9997 | 0.5321 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:01 | EHQRLVSM | 0.9997 | 0.7776 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:02 | EHQRLVSM | 0.9993 | 0.8436 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:01 | EHQRLVSM | 0.9993 | 0.8142 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B44:03 | AEHQRLVSM | 0.999 | 0.8469 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B48:01 | SQMAEHQRL | 0.9987 | 0.5688 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:01 | HQRLVSMNM | 0.9987 | 0.7339 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:22 | QMAEHQRLV | 0.998 | 0.5708 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B13:01 | AEHQRLVSM | 0.9974 | 0.8604 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:24 | SQMAEHQRL | 0.9968 | 0.5076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:02 | AEHQRLVSM | 0.9954 | 0.7264 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:01 | AEHQRLVSM | 0.9954 | 0.7264 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:02 | SQMAEHQRL | 0.9953 | 0.6076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:01 | SQMAEHQRL | 0.9953 | 0.6076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:11 | QMAEHQRLV | 0.9953 | 0.5527 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:13 | QMAEHQRLV | 0.9953 | 0.6703 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:01 | SQMAEHQRL | 0.9948 | 0.8076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B50:02 | AEHQRLVSM | 0.9947 | 0.556 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:27 | QMAEHQRLV | 0.9944 | 0.5725 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:38 | QMAEHQRLV | 0.9832 | 0.694 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:35 | QMAEHQRLV | 0.9797 | 0.5432 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:20 | QMAEHQRLV | 0.9789 | 0.53 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B45:01 | AEHQRLVSM | 0.9776 | 0.8271 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:01 | AEHQRLVSM | 0.9686 | 0.8159 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:25 | HQRLVSMNM | 0.9611 | 0.8483 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:01 | SQMAEHQRL | 0.9584 | 0.8171 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:21 | SQMAEHQRL | 0.9543 | 0.6285 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:03 | SQMAEHQRL | 0.946 | 0.6719 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B13:02 | SQMAEHQRL | 0.9432 | 0.5784 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:02 | HQRLVSMNM | 0.9377 | 0.877 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:03 | HQRLVSMNM | 0.9348 | 0.6223 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B08:09 | AEHQRLVSM | 0.9337 | 0.5544 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B13:01 | SQMAEHQRL | 0.8946 | 0.9592 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:13 | SQMAEHQRL | 0.8701 | 0.8618 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:03 | AEHQRLVSM | 0.8674 | 0.5688 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:13 | AEHQRLVSM | 0.8502 | 0.8594 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:02 | SQMAEHQRL | 0.8421 | 0.9708 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:01 | SQMAEHQRL | 0.8202 | 0.964 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B41:01 | AEHQRLVSM | 0.818 | 0.7136 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B50:01 | AEHQRLVSM | 0.685 | 0.5922 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:37 | SQMAEHQRL | 0.6333 | 0.5533 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B13:02 | QMAEHQRLV | 0.2961 | 0.7428 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B52:01 | SQMAEHQRL | 0.1669 | 0.8617 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B13:02 | SQMAEHQRLV | 0.8925 | 0.8002 | 7 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:12 | EHQRLVSM | 0.9997 | 0.7791 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:09 | EHQRLVSM | 0.9997 | 0.573 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:05 | EHQRLVSM | 0.999 | 0.747 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:03 | EHQRLVSM | 0.9329 | 0.6415 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B40:06 | AEHQRLVSM | 0.9987 | 0.5881 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:03 | QMAEHQRLV | 0.9984 | 0.9936 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:05 | QMAEHQRLV | 0.997 | 0.6636 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:07 | HQRLVSMNM | 0.9938 | 0.5348 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:04 | HQRLVSMNM | 0.9892 | 0.7443 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:12 | SQMAEHQRL | 0.9667 | 0.8429 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:09 | SQMAEHQRL | 0.9596 | 0.5646 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:04 | SQMAEHQRL | 0.9556 | 0.9143 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:21 | HQRLVSMNM | 0.9351 | 0.8245 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:08 | AEHQRLVSM | 0.9266 | 0.8735 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:08 | SQMAEHQRL | 0.912 | 0.8291 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:09 | AEHQRLVSM | 0.8826 | 0.6661 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:03 | AEHQRLVSM | 0.876 | 0.7567 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:05 | SQMAEHQRL | 0.8448 | 0.8078 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:12 | AEHQRLVSM | 0.8423 | 0.8106 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:04 | AEHQRLVSM | 0.8272 | 0.6935 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:05 | SQMAEHQRL | 0.7964 | 0.9098 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B14:03 | SQMAEHQRL | 0.7588 | 0.6863 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:31 | EHQRLVSM | 0.9997 | 0.7727 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:05 | EHQRLVSM | 0.9993 | 0.8142 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:11 | EHQRLVSM | 0.995 | 0.6519 | 11 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B44:13 | AEHQRLVSM | 0.999 | 0.8469 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B40:04 | AEHQRLVSM | 0.999 | 0.6796 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B44:26 | AEHQRLVSM | 0.999 | 0.8469 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B44:07 | AEHQRLVSM | 0.999 | 0.8469 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:27 | HQRLVSMNM | 0.9987 | 0.7193 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:33 | HQRLVSMNM | 0.9987 | 0.7339 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:34 | HQRLVSMNM | 0.9987 | 0.7339 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:125 | HQRLVSMNM | 0.9987 | 0.7339 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:135 | HQRLVSMNM | 0.9987 | 0.738 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:03 | QMAEHQRLV | 0.9984 | 0.702 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:50 | HQRLVSMNM | 0.9976 | 0.7581 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:24 | SQMAEHQRL | 0.9959 | 0.8911 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:50 | SQMAEHQRL | 0.9952 | 0.8242 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:135 | SQMAEHQRL | 0.9948 | 0.9009 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:125 | SQMAEHQRL | 0.9948 | 0.8076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:33 | SQMAEHQRL | 0.9948 | 0.8076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:34 | SQMAEHQRL | 0.9948 | 0.8076 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:53 | HQRLVSMNM | 0.9944 | 0.7109 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:27 | SQMAEHQRL | 0.9942 | 0.8884 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:17 | QMAEHQRLV | 0.9938 | 0.9918 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:35 | HQRLVSMNM | 0.9938 | 0.6738 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:02 | QMAEHQRLV | 0.9938 | 0.9918 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:06 | SQMAEHQRL | 0.9896 | 0.9864 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:54 | HQRLVSMNM | 0.9888 | 0.6871 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C07:04 | SQMAEHQRL | 0.987 | 0.9312 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:04 | AEHQRLVSM | 0.9797 | 0.8261 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:07 | AEHQRLVSM | 0.9769 | 0.7438 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:02 | SQMAEHQRL | 0.9753 | 0.8703 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:06 | AEHQRLVSM | 0.9736 | 0.8377 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:08 | AEHQRLVSM | 0.9725 | 0.7673 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:12 | SQMAEHQRL | 0.9693 | 0.7775 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:73 | SQMAEHQRL | 0.9692 | 0.779 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:05 | AEHQRLVSM | 0.9686 | 0.8159 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:39 | HQRLVSMNM | 0.9638 | 0.6819 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:11 | AEHQRLVSM | 0.9607 | 0.8001 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:31 | SQMAEHQRL | 0.9605 | 0.8456 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:73 | HQRLVSMNM | 0.9566 | 0.846 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B18:03 | AEHQRLVSM | 0.9566 | 0.7986 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:06 | SQMAEHQRL | 0.9543 | 0.6285 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:30 | SQMAEHQRL | 0.9491 | 0.7823 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:06 | QMAEHQRLV | 0.9446 | 0.9892 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B41:03 | AEHQRLVSM | 0.9258 | 0.5551 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:11 | AEHQRLVSM | 0.9159 | 0.7693 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:54 | AEHQRLVSM | 0.9084 | 0.6258 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:68 | SQMAEHQRL | 0.9084 | 0.5944 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:30 | HQRLVSMNM | 0.9073 | 0.7799 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:53 | SQMAEHQRL | 0.896 | 0.7526 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B48:02 | SQMAEHQRL | 0.8906 | 0.9421 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:11 | SQMAEHQRL | 0.8847 | 0.8164 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:12 | AEHQRLVSM | 0.8792 | 0.6491 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:02 | AEHQRLVSM | 0.8776 | 0.8551 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:53 | AEHQRLVSM | 0.8642 | 0.6587 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:12 | HQRLVSMNM | 0.8586 | 0.672 | 12 | 21 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B39:31 | AEHQRLVSM | 0.8574 | 0.8079 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:54 | SQMAEHQRL | 0.826 | 0.7326 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B38:05 | SQMAEHQRL | 0.8202 | 0.964 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:73 | AEHQRLVSM | 0.8096 | 0.7362 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:30 | AEHQRLVSM | 0.7874 | 0.71 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:20 | SQMAEHQRL | 0.778 | 0.9407 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B35:28 | SQMAEHQRL | 0.7754 | 0.9485 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B50:05 | AEHQRLVSM | 0.685 | 0.5922 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B50:04 | AEHQRLVSM | 0.685 | 0.5922 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B15:09 | SQMAEHQRL | 0.6712 | 0.7234 | 7 | 16 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B48:02 | AEHQRLVSM | 0.6616 | 0.7406 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-C06:08 | QMAEHQRLV | 0.535 | 0.9859 | 8 | 17 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-B35:28 | AEHQRLVSM | 0.4589 | 0.7587 | 10 | 19 |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 | HLA-A02:03 | SQMAEHQRLV | 0.978 | 0.6904 | 7 | 17 |
Top |
Potential FusionNeoAntigen Information of SYNE1-CACNA1C in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SYNE1-CACNA1C |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2140 | ESQMAEHQRLVSMN | SYNE1 | CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 18614 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SYNE1-CACNA1C |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2140 | ESQMAEHQRLVSMN | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 2140 | ESQMAEHQRLVSMN | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 2140 | ESQMAEHQRLVSMN | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 2140 | ESQMAEHQRLVSMN | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 2140 | ESQMAEHQRLVSMN | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 2140 | ESQMAEHQRLVSMN | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 2140 | ESQMAEHQRLVSMN | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 2140 | ESQMAEHQRLVSMN | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 2140 | ESQMAEHQRLVSMN | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 2140 | ESQMAEHQRLVSMN | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 2140 | ESQMAEHQRLVSMN | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of SYNE1-CACNA1C |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 10 | 19 | AEHQRLVSM | GAACATCAGCGCCTGGTCTCCATGAAC |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 11 | 19 | EHQRLVSM | CATCAGCGCCTGGTCTCCATGAAC |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 12 | 21 | HQRLVSMNM | CAGCGCCTGGTCTCCATGAACATGCCT |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 7 | 16 | SQMAEHQRL | CAGATGGCTGAACATCAGCGCCTGGTC |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 7 | 17 | SQMAEHQRLV | CAGATGGCTGAACATCAGCGCCTGGTCTCC |
SYNE1-CACNA1C | chr6 | 152614723 | chr12 | 2778099 | 8 | 17 | QMAEHQRLV | ATGGCTGAACATCAGCGCCTGGTCTCC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SYNE1-CACNA1C |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | SYNE1-CACNA1C | chr6 | 152614723 | ENST00000265368 | chr12 | 2778099 | ENST00000335762 | TCGA-C8-A1HJ-01A |
Top |
Potential target of CAR-T therapy development for SYNE1-CACNA1C |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SYNE1-CACNA1C |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SYNE1-CACNA1C |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |