Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SYNPO2-SUPT3H

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SYNPO2-SUPT3H
	FusionPDB ID: 88476
	FusionGDB2.0 ID: 88476
		Hgene	Tgene
	Gene symbol	SYNPO2	SUPT3H
	Gene ID	171024	8464
	Gene name	synaptopodin 2	SPT3 homolog, SAGA and STAGA complex component
	Synonyms	-	SPT3\|SPT3L
	Cytomap	4q26	6p21.1
	Type of gene	protein-coding	protein-coding
	Description	synaptopodin-2genethonin-2myopodin	transcription initiation protein SPT3 homologSPT3-like proteinsuppressor of Ty 3 homolog
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000307142, ENST00000429713, ENST00000434046, ENST00000448416,	ENST00000371458, ENST00000459689, ENST00000306867, ENST00000371459, ENST00000371460, ENST00000371461,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 5=175	19 X 9 X 9=1539
	# samples	9	22
	** MAII score	log2(9/175*10)=-0.959358015502654 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/1539*10)=-2.80641780280355 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SYNPO2 [Title/Abstract] AND SUPT3H [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SYNPO2 [Title/Abstract] AND SUPT3H [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SYNPO2(119810296)-SUPT3H(44988369), # samples:1
Anticipated loss of major functional domain due to fusion event.	SYNPO2-SUPT3H seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNPO2-SUPT3H seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	SUPT3H	GO:0016578	histone deubiquitination	18206972
Tgene	SUPT3H	GO:0043966	histone H3 acetylation	11564863

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:119810296/chr6:44988369)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SYNPO2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SUPT3H (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000371460	SUPT3H	chr6	44988369	-	2153	301	196	1068	290
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000371459	SUPT3H	chr6	44988369	-	2040	301	196	1068	290
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000371461	SUPT3H	chr6	44988369	-	1069	301	196	1068	291
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000306867	SUPT3H	chr6	44988369	-	1069	301	196	1068	291
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000371460	SUPT3H	chr6	44988369	-	2140	288	183	1055	290
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000371459	SUPT3H	chr6	44988369	-	2027	288	183	1055	290
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000371461	SUPT3H	chr6	44988369	-	1056	288	183	1055	290
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000306867	SUPT3H	chr6	44988369	-	1056	288	183	1055	290
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000371460	SUPT3H	chr6	44988369	-	2139	287	182	1054	290
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000371459	SUPT3H	chr6	44988369	-	2026	287	182	1054	290
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000371461	SUPT3H	chr6	44988369	-	1055	287	182	1054	291
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000306867	SUPT3H	chr6	44988369	-	1055	287	182	1054	291
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000371460	SUPT3H	chr6	44988369	-	1957	105	0	872	290
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000371459	SUPT3H	chr6	44988369	-	1844	105	0	872	290
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000371461	SUPT3H	chr6	44988369	-	873	105	0	872	290
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000306867	SUPT3H	chr6	44988369	-	873	105	0	872	290

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000307142	ENST00000371460	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001314829	0.9986852
ENST00000307142	ENST00000371459	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001360872	0.99863917
ENST00000307142	ENST00000371461	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.0030979	0.9969021
ENST00000307142	ENST00000306867	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.0030979	0.9969021
ENST00000448416	ENST00000371460	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001161343	0.9988387
ENST00000448416	ENST00000371459	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001210781	0.99878925
ENST00000448416	ENST00000371461	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.002884296	0.99711573
ENST00000448416	ENST00000306867	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.002884296	0.99711573
ENST00000429713	ENST00000371460	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001184588	0.9988154
ENST00000429713	ENST00000371459	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001230246	0.9987697
ENST00000429713	ENST00000371461	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.002848521	0.99715155
ENST00000429713	ENST00000306867	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.002848521	0.99715155
ENST00000434046	ENST00000371460	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.000898175	0.9991019
ENST00000434046	ENST00000371459	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.000955055	0.99904495
ENST00000434046	ENST00000371461	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001880038	0.9981199
ENST00000434046	ENST00000306867	SYNPO2	chr4	119810296	+	SUPT3H	chr6	44988369	-	0.001880038	0.9981199

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SYNPO2-SUPT3H

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SYNPO2	chr4	119810296	SUPT3H	chr6	44988369	105	35	GGKEQKQPLQVAKLQQAAEVSQLRGA
SYNPO2	chr4	119810296	SUPT3H	chr6	44988369	287	35	GGKEQKQPLQVAKLQQAAEVSQLRGA
SYNPO2	chr4	119810296	SUPT3H	chr6	44988369	288	35	GGKEQKQPLQVAKLQQAAEVSQLRGA
SYNPO2	chr4	119810296	SUPT3H	chr6	44988369	301	35	GGKEQKQPLQVAKLQQAAEVSQLRGA

Top

Potential FusionNeoAntigen Information of SYNPO2-SUPT3H in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SYNPO2-SUPT3H_119810296_44988369.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B13:02	KQPLQVAKL	0.4837	0.6405	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B13:01	KQPLQVAKL	0.36	0.9506	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B39:13	KQPLQVAKL	0.2279	0.8727	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B52:01	KQPLQVAKL	0.0177	0.9458	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B56:01	QPLQVAKLQQA	0.7569	0.7146	6	17
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B42:02	QPLQVAKL	0.9003	0.7118	6	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B42:01	QPLQVAKL	0.8605	0.7008	6	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B39:10	QPLQVAKL	0.3983	0.9531	6	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B15:04	KQPLQVAKL	0.9323	0.8107	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C07:13	KQPLQVAKL	0.7704	0.8696	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C07:29	KQPLQVAKL	0.7586	0.8929	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C01:17	KQPLQVAKL	0.6601	0.916	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B15:04	LQVAKLQQA	0.6074	0.8729	8	17
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C01:30	KQPLQVAKL	0.5211	0.9292	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B39:08	KQPLQVAKL	0.396	0.8764	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-A02:02	KLQQAAEVSQL	0.9974	0.5411	12	23
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B54:01	QPLQVAKLQQA	0.9498	0.8519	6	17
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B67:01	QPLQVAKL	0.4441	0.8987	6	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B15:73	KQPLQVAKL	0.9175	0.8992	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B15:30	KQPLQVAKL	0.8108	0.8347	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C01:03	KQPLQVAKL	0.8081	0.8987	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-C01:02	KQPLQVAKL	0.7371	0.9139	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B39:02	KQPLQVAKL	0.3883	0.8767	5	14
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B15:73	KLQQAAEVSQL	0.9974	0.9609	12	23
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	HLA-B55:02	QPLQVAKLQQA	0.825	0.6967	6	17

Top

Potential FusionNeoAntigen Information of SYNPO2-SUPT3H in HLA II

SYNPO2-SUPT3H_119810296_44988369.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0101	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0101	QKQPLQVAKLQQAAE	4	19
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0103	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0103	QKQPLQVAKLQQAAE	4	19
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0104	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0104	QKQPLQVAKLQQAAE	4	19
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0106	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0106	QKQPLQVAKLQQAAE	4	19
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0107	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0107	QKQPLQVAKLQQAAE	4	19
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0108	KQPLQVAKLQQAAEV	5	20
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	301	DRB4-0108	QKQPLQVAKLQQAAE	4	19

Top

Fusion breakpoint peptide structures of SYNPO2-SUPT3H

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7462	QPLQVAKLQQAAEV	SYNPO2	SUPT3H	chr4	119810296	chr6	44988369	301

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SYNPO2-SUPT3H

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7462	QPLQVAKLQQAAEV	-5.68508	-5.79848
HLA-B14:02	3BVN	7462	QPLQVAKLQQAAEV	-4.48181	-5.51711
HLA-B52:01	3W39	7462	QPLQVAKLQQAAEV	-6.58333	-6.69673
HLA-B52:01	3W39	7462	QPLQVAKLQQAAEV	-5.63259	-6.66789
HLA-A11:01	4UQ2	7462	QPLQVAKLQQAAEV	-10.3303	-10.4437
HLA-A11:01	4UQ2	7462	QPLQVAKLQQAAEV	-6.29447	-7.32977
HLA-A24:02	5HGA	7462	QPLQVAKLQQAAEV	-7.77035	-7.88375
HLA-A24:02	5HGA	7462	QPLQVAKLQQAAEV	-5.35627	-6.39157
HLA-B27:05	6PYJ	7462	QPLQVAKLQQAAEV	-3.97515	-5.01045
HLA-B44:05	3DX8	7462	QPLQVAKLQQAAEV	-5.81963	-5.93303
HLA-B44:05	3DX8	7462	QPLQVAKLQQAAEV	-4.86027	-5.89557
HLA-A02:01	6TDR	7462	QPLQVAKLQQAAEV	-5.17978	-6.21508
HLA-A02:01	6TDR	7462	QPLQVAKLQQAAEV	-5.36237	-5.47577

Top

Vaccine Design for the FusionNeoAntigens of SYNPO2-SUPT3H

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	12	23	KLQQAAEVSQL	AAGTTACAGCAAGCTGCTGAAGTTTCTCAGCTG
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	5	14	KQPLQVAKL	AAGCAGCCCTTACAAGTTGCAAAGTTA
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	6	14	QPLQVAKL	CAGCCCTTACAAGTTGCAAAGTTA
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	6	17	QPLQVAKLQQA	CAGCCCTTACAAGTTGCAAAGTTACAGCAAGCT
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	8	17	LQVAKLQQA	TTACAAGTTGCAAAGTTACAGCAAGCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	4	19	QKQPLQVAKLQQAAE	CAGAAGCAGCCCTTACAAGTTGCAAAGTTACAGCAAGCTGCTGAA
SYNPO2-SUPT3H	chr4	119810296	chr6	44988369	5	20	KQPLQVAKLQQAAEV	AAGCAGCCCTTACAAGTTGCAAAGTTACAGCAAGCTGCTGAAGTT

Top

Information of the samples that have these potential fusion neoantigens of SYNPO2-SUPT3H

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	SYNPO2-SUPT3H	chr4	119810296	ENST00000307142	chr6	44988369	ENST00000306867	TCGA-BR-A4J7-01A

Top

Potential target of CAR-T therapy development for SYNPO2-SUPT3H

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SYNPO2-SUPT3H

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SYNPO2-SUPT3H

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)