Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SYNPO2-TRIM24

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SYNPO2-TRIM24
	FusionPDB ID: 88478
	FusionGDB2.0 ID: 88478
		Hgene	Tgene
	Gene symbol	SYNPO2	TRIM24
	Gene ID	171024	8805
	Gene name	synaptopodin 2	tripartite motif containing 24
	Synonyms	-	PTC6\|RNF82\|TF1A\|TIF1\|TIF1A\|TIF1ALPHA\|hTIF1
	Cytomap	4q26	7q33-q34
	Type of gene	protein-coding	protein-coding
	Description	synaptopodin-2genethonin-2myopodin	transcription intermediary factor 1-alphaE3 ubiquitin-protein ligase TRIM24RING finger protein 82RING-type E3 ubiquitin transferase TIF1-alphaTIF1-alphatranscriptional intermediary factor 1
	Modification date	20200313	20200313
	UniProtAcc	.	O15164 Main function of 5'-partner protein: FUNCTION: Transcriptional coactivator that interacts with numerous nuclear receptors and coactivators and modulates the transcription of target genes. Interacts with chromatin depending on histone H3 modifications, having the highest affinity for histone H3 that is both unmodified at 'Lys-4' (H3K4me0) and acetylated at 'Lys-23' (H3K23ac). Has E3 protein-ubiquitin ligase activity. Promotes ubiquitination and proteasomal degradation of p53/TP53. Plays a role in the regulation of cell proliferation and apoptosis, at least in part via its effects on p53/TP53 levels. Up-regulates ligand-dependent transcription activation by AR, GCR/NR3C1, thyroid hormone receptor (TR) and ESR1. Modulates transcription activation by retinoic acid (RA) receptors, including RARA. Plays a role in regulating retinoic acid-dependent proliferation of hepatocytes (By similarity). {ECO:0000250, ECO:0000269\|PubMed:16322096, ECO:0000269\|PubMed:19556538, ECO:0000269\|PubMed:21164480}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000307142, ENST00000429713, ENST00000434046, ENST00000448416,	ENST00000497516, ENST00000343526, ENST00000415680,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 5=175	10 X 9 X 7=630
	# samples	9	11
	** MAII score	log2(9/175*10)=-0.959358015502654 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/630*10)=-2.51784830486262 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SYNPO2 [Title/Abstract] AND TRIM24 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SYNPO2 [Title/Abstract] AND TRIM24 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SYNPO2(119810296)-TRIM24(138252226), # samples:2
Anticipated loss of major functional domain due to fusion event.	SYNPO2-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNPO2-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SYNPO2-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SYNPO2-TRIM24 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	TRIM24	GO:0016567	protein ubiquitination	19556538
Tgene	TRIM24	GO:0071391	cellular response to estrogen stimulus	21164480

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:119810296/chr7:138252226)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SYNPO2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TRIM24 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252226	+	6966	301	196	1923	575
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252226	+	2558	301	196	1923	575
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252226	+	6953	288	183	1910	575
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252226	+	2545	288	183	1910	575
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252226	+	6952	287	182	1909	575
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252226	+	2544	287	182	1909	575
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252226	+	6770	105	0	1727	575
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252226	+	2362	105	0	1727	575
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252225	+	6966	301	196	1923	575
ENST00000307142	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252225	+	2558	301	196	1923	575
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252225	+	6953	288	183	1910	575
ENST00000448416	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252225	+	2545	288	183	1910	575
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252225	+	6952	287	182	1909	575
ENST00000429713	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252225	+	2544	287	182	1909	575
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000343526	TRIM24	chr7	138252225	+	6770	105	0	1727	575
ENST00000434046	SYNPO2	chr4	119810296	+	ENST00000415680	TRIM24	chr7	138252225	+	2362	105	0	1727	575

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000307142	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.000377291	0.9996227
ENST00000307142	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.001676403	0.9983236
ENST00000448416	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.000377126	0.9996228
ENST00000448416	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.001688363	0.99831164
ENST00000429713	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.000376495	0.99962354
ENST00000429713	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.001666121	0.9983339
ENST00000434046	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.000338802	0.9996612
ENST00000434046	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252226	+	0.001206736	0.99879324
ENST00000307142	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.000377291	0.9996227
ENST00000307142	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.001676403	0.9983236
ENST00000448416	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.000377126	0.9996228
ENST00000448416	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.001688363	0.99831164
ENST00000429713	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.000376495	0.99962354
ENST00000429713	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.001666121	0.9983339
ENST00000434046	ENST00000343526	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.000338802	0.9996612
ENST00000434046	ENST00000415680	SYNPO2	chr4	119810296	+	TRIM24	chr7	138252225	+	0.001206736	0.99879324

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SYNPO2-TRIM24

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SYNPO2	chr4	119810296	TRIM24	chr7	138252225	105	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252225	287	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252225	288	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252225	301	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252226	105	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252226	287	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252226	288	35	GGKEQKQPLQVAKQPPPRLINFQNHS
SYNPO2	chr4	119810296	TRIM24	chr7	138252226	301	35	GGKEQKQPLQVAKQPPPRLINFQNHS

Top

Potential FusionNeoAntigen Information of SYNPO2-TRIM24 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SYNPO2-TRIM24_119810296_138252225.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B13:02	KQPPPRLI	0.976	0.533	12	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B52:01	KQPPPRLI	0.7659	0.8497	12	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A68:24	QVAKQPPPR	0.9929	0.5046	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A68:08	QVAKQPPPR	0.9832	0.532	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A31:06	QVAKQPPPR	0.9713	0.5129	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A74:11	QVAKQPPPR	0.9699	0.6362	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A74:03	QVAKQPPPR	0.9699	0.6362	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A74:09	QVAKQPPPR	0.9699	0.6362	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:17	VAKQPPPRL	0.9545	0.9174	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B52:01	VAKQPPPRL	0.9501	0.9732	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A31:02	QVAKQPPPR	0.9374	0.6322	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:16	VAKQPPPRL	0.932	0.8291	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A66:03	QVAKQPPPR	0.8821	0.513	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B08:09	VAKQPPPRL	0.8596	0.6271	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A30:08	VAKQPPPRL	0.8198	0.7439	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B07:10	VAKQPPPRL	0.7041	0.5822	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B81:01	VAKQPPPRL	0.5164	0.5261	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B52:01	AKQPPPRLI	0.029	0.9135	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:01	KQPPPRLINF	0.9998	0.9126	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:03	KQPPPRLINF	0.9836	0.8055	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A32:13	KQPPPRLINF	0.9424	0.951	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B13:01	KQPPPRLINF	0.7118	0.8652	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:07	VAKQPPPRL	0.9991	0.9866	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C15:04	VAKQPPPRL	0.9988	0.9214	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:19	VAKQPPPRL	0.9988	0.9843	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:08	VAKQPPPRL	0.9983	0.9257	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C15:06	VAKQPPPRL	0.9962	0.9348	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A68:01	QVAKQPPPR	0.9929	0.5046	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C12:04	VAKQPPPRL	0.9832	0.9948	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:03	VAKQPPPRL	0.9798	0.9936	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C12:12	VAKQPPPRL	0.977	0.9369	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A31:01	QVAKQPPPR	0.976	0.6063	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C04:06	VAKQPPPRL	0.9639	0.9373	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B51:07	VAKQPPPRL	0.9526	0.8723	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C04:14	VAKQPPPRL	0.9383	0.9382	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C12:16	VAKQPPPRL	0.9074	0.9617	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B07:04	VAKQPPPRL	0.9034	0.5215	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C02:06	VAKQPPPRL	0.8812	0.9576	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C08:04	VAKQPPPRL	0.8391	0.9795	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C08:13	VAKQPPPRL	0.8391	0.9795	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:05	VAKQPPPRL	0.7556	0.9736	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:19	VAKQPPPRL	0.7079	0.7584	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C01:17	VAKQPPPRL	0.6898	0.9566	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C01:30	VAKQPPPRL	0.6392	0.9689	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:14	VAKQPPPRL	0.6098	0.9873	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:27	VAKQPPPRL	0.5699	0.9711	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:95	VAKQPPPRL	0.566	0.7652	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:13	VAKQPPPRL	0.5318	0.9351	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:29	VAKQPPPRL	0.5287	0.9595	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C08:03	VAKQPPPRL	0.3873	0.9885	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:04	KQPPPRLINF	0.9987	0.8965	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:07	KQPPPRLINF	0.9986	0.731	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:05	KQPPPRLINF	0.7761	0.9452	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C15:09	VAKQPPPRL	0.9988	0.9214	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:04	VAKQPPPRL	0.9986	0.9902	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:03	VAKQPPPRL	0.9986	0.9902	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:05	VAKQPPPRL	0.9982	0.9307	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:17	VAKQPPPRL	0.9981	0.9764	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:67	VAKQPPPRL	0.998	0.9835	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C15:02	VAKQPPPRL	0.9958	0.8857	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C15:05	VAKQPPPRL	0.9948	0.8906	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:02	VAKQPPPRL	0.9946	0.9779	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:17	VAKQPPPRL	0.9748	0.9939	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:02	VAKQPPPRL	0.9748	0.9939	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C12:03	VAKQPPPRL	0.9722	0.9847	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A74:01	QVAKQPPPR	0.9699	0.6362	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B58:06	VAKQPPPRL	0.9664	0.9116	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C04:04	VAKQPPPRL	0.961	0.9266	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:06	VAKQPPPRL	0.9545	0.9925	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C16:04	VAKQPPPRL	0.9516	0.9817	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C03:06	VAKQPPPRL	0.9476	0.991	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A66:02	QVAKQPPPR	0.9191	0.5258	9	18
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:04	VAKQPPPRL	0.9108	0.9519	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C12:02	VAKQPPPRL	0.8875	0.9718	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C02:10	VAKQPPPRL	0.8772	0.9781	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C02:02	VAKQPPPRL	0.8772	0.9781	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:08	VAKQPPPRL	0.8542	0.9914	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B35:13	VAKQPPPRL	0.8358	0.9403	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:22	VAKQPPPRL	0.8299	0.7252	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C16:02	VAKQPPPRL	0.7692	0.9934	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C16:01	VAKQPPPRL	0.7654	0.9819	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B08:12	VAKQPPPRL	0.7524	0.5958	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B07:13	VAKQPPPRL	0.7349	0.8816	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:30	VAKQPPPRL	0.7314	0.9508	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C01:02	VAKQPPPRL	0.6577	0.9531	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:22	AKQPPPRLI	0.6483	0.7574	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C01:03	VAKQPPPRL	0.6412	0.9537	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:01	VAKQPPPRL	0.6027	0.715	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:08	AKQPPPRLI	0.5962	0.99	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C07:04	AKQPPPRLI	0.4675	0.9578	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:06	AKQPPPRLI	0.3928	0.993	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C17:01	VAKQPPPRL	0.388	0.95	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C08:01	VAKQPPPRL	0.3873	0.9885	10	19
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:02	AKQPPPRLI	0.0713	0.9938	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-C06:17	AKQPPPRLI	0.0713	0.9938	11	20
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:24	KQPPPRLINF	0.9999	0.846	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:135	KQPPPRLINF	0.9998	0.9072	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:125	KQPPPRLINF	0.9998	0.9126	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:33	KQPPPRLINF	0.9998	0.9126	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:34	KQPPPRLINF	0.9998	0.9126	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:27	KQPPPRLINF	0.9998	0.9069	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:50	KQPPPRLINF	0.9997	0.8833	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:53	KQPPPRLINF	0.9997	0.9092	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:68	KQPPPRLINF	0.9992	0.6634	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:54	KQPPPRLINF	0.9984	0.8911	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:35	KQPPPRLINF	0.9977	0.8849	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:73	KQPPPRLINF	0.995	0.9145	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:12	KQPPPRLINF	0.992	0.8782	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-A32:01	KQPPPRLINF	0.9871	0.9138	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:30	KQPPPRLINF	0.9871	0.9183	12	22
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	301	HLA-B15:39	KQPPPRLINF	0.9702	0.8529	12	22

Top

Potential FusionNeoAntigen Information of SYNPO2-TRIM24 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of SYNPO2-TRIM24

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7463	QPLQVAKQPPPRLI	SYNPO2	TRIM24	chr4	119810296	chr7	138252225	301

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SYNPO2-TRIM24

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7463	QPLQVAKQPPPRLI	-7.9962	-8.1096
HLA-B14:02	3BVN	7463	QPLQVAKQPPPRLI	-5.70842	-6.74372
HLA-B52:01	3W39	7463	QPLQVAKQPPPRLI	-6.83737	-6.95077
HLA-B52:01	3W39	7463	QPLQVAKQPPPRLI	-4.4836	-5.5189
HLA-A11:01	4UQ2	7463	QPLQVAKQPPPRLI	-10.0067	-10.1201
HLA-A11:01	4UQ2	7463	QPLQVAKQPPPRLI	-9.03915	-10.0745
HLA-A24:02	5HGA	7463	QPLQVAKQPPPRLI	-6.56204	-6.67544
HLA-A24:02	5HGA	7463	QPLQVAKQPPPRLI	-5.42271	-6.45801
HLA-B44:05	3DX8	7463	QPLQVAKQPPPRLI	-7.85648	-8.89178
HLA-B44:05	3DX8	7463	QPLQVAKQPPPRLI	-5.3978	-5.5112
HLA-A02:01	6TDR	7463	QPLQVAKQPPPRLI	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of SYNPO2-TRIM24

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	10	19	VAKQPPPRL	GTTGCAAAGCAACCGCCTCCACGTTTG
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	11	20	AKQPPPRLI	GCAAAGCAACCGCCTCCACGTTTGATA
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	12	20	KQPPPRLI	AAGCAACCGCCTCCACGTTTGATA
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	12	22	KQPPPRLINF	AAGCAACCGCCTCCACGTTTGATAAACTTT
SYNPO2-TRIM24	chr4	119810296	chr7	138252225	9	18	QVAKQPPPR	CAAGTTGCAAAGCAACCGCCTCCACGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of SYNPO2-TRIM24

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	SYNPO2-TRIM24	chr4	119810296	ENST00000307142	chr7	138252225	ENST00000343526	TCGA-AN-A0FJ

Top

Potential target of CAR-T therapy development for SYNPO2-TRIM24

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SYNPO2-TRIM24

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SYNPO2-TRIM24

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	TRIM24	C0238463	Papillary thyroid carcinoma	2	ORPHANET
Tgene	TRIM24	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
Tgene	TRIM24	C2239176	Liver carcinoma	1	CTD_human
Tgene	TRIM24	C3658266	Prostatic Cancer, Castration-Resistant	1	CTD_human
Tgene	TRIM24	C3658267	Prostatic Neoplasms, Castration-Resistant	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)