Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TBCD-NFIC

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TBCD-NFIC
	FusionPDB ID: 89476
	FusionGDB2.0 ID: 89476
		Hgene	Tgene
	Gene symbol	TBCD	NFIC
	Gene ID	6904	4782
	Gene name	tubulin folding cofactor D	nuclear factor I C
	Synonyms	PEBAT\|SSD-1\|tfcD	CTF\|CTF5\|NF-I\|NFI
	Cytomap	17q25.3	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	tubulin-specific chaperone Dbeta-tubulin cofactor D	nuclear factor 1 C-typeCCAAT-box-binding transcription factorNF-I/CNF1-CTGGCA-binding proteinnuclear factor I/C (CCAAT-binding transcription factor)
	Modification date	20200313	20200313
	UniProtAcc	.	P08651 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000576691, ENST00000355528, ENST00000539345, ENST00000397466,	ENST00000341919, ENST00000346156, ENST00000395111, ENST00000443272, ENST00000586919, ENST00000589123, ENST00000590282, ENST00000588839,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	20 X 23 X 13=5980	24 X 21 X 9=4536
	# samples	27	27
	** MAII score	log2(27/5980*10)=-4.46911417203464 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(27/4536*10)=-4.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TBCD [Title/Abstract] AND NFIC [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TBCD [Title/Abstract] AND NFIC [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TBCD(80899359)-NFIC(3381709), # samples:1
Anticipated loss of major functional domain due to fusion event.	TBCD-NFIC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBCD-NFIC seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBCD-NFIC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TBCD-NFIC seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TBCD	GO:0006457	protein folding	20740604
Hgene	TBCD	GO:0007021	tubulin complex assembly	28158450
Hgene	TBCD	GO:0007023	post-chaperonin tubulin folding pathway	11847227
Hgene	TBCD	GO:0031115	negative regulation of microtubule polymerization	10831612\|20740604
Tgene	NFIC	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Tgene	NFIC	GO:0045944	positive regulation of transcription by RNA polymerase II	1524678\|19706729

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:80899359/chr19:3381709)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TBCD (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NFIC (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000355528	TBCD	chr17	80899359	+	ENST00000589123	NFIC	chr19	3381709	+	11639	3694	130	5190	1686
ENST00000355528	TBCD	chr17	80899359	+	ENST00000346156	NFIC	chr19	3381709	+	5801	3694	130	4911	1593
ENST00000355528	TBCD	chr17	80899359	+	ENST00000395111	NFIC	chr19	3381709	+	5410	3694	130	4983	1617
ENST00000355528	TBCD	chr17	80899359	+	ENST00000586919	NFIC	chr19	3381709	+	4912	3694	130	4911	1594
ENST00000355528	TBCD	chr17	80899359	+	ENST00000341919	NFIC	chr19	3381709	+	5149	3694	130	4950	1606
ENST00000355528	TBCD	chr17	80899359	+	ENST00000590282	NFIC	chr19	3381709	+	5168	3694	130	4983	1617
ENST00000355528	TBCD	chr17	80899359	+	ENST00000443272	NFIC	chr19	3381709	+	5329	3694	130	5190	1686
ENST00000539345	TBCD	chr17	80899359	+	ENST00000589123	NFIC	chr19	3381709	+	11659	3714	36	5210	1724
ENST00000539345	TBCD	chr17	80899359	+	ENST00000346156	NFIC	chr19	3381709	+	5821	3714	36	4931	1631
ENST00000539345	TBCD	chr17	80899359	+	ENST00000395111	NFIC	chr19	3381709	+	5430	3714	36	5003	1655
ENST00000539345	TBCD	chr17	80899359	+	ENST00000586919	NFIC	chr19	3381709	+	4932	3714	36	4931	1631
ENST00000539345	TBCD	chr17	80899359	+	ENST00000341919	NFIC	chr19	3381709	+	5169	3714	36	4970	1644
ENST00000539345	TBCD	chr17	80899359	+	ENST00000590282	NFIC	chr19	3381709	+	5188	3714	36	5003	1655
ENST00000539345	TBCD	chr17	80899359	+	ENST00000443272	NFIC	chr19	3381709	+	5349	3714	36	5210	1724

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000355528	ENST00000589123	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.000898682	0.9991014
ENST00000355528	ENST00000346156	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002777295	0.99722266
ENST00000355528	ENST00000395111	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002480136	0.9975198
ENST00000355528	ENST00000586919	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002895283	0.9971047
ENST00000355528	ENST00000341919	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002698147	0.9973018
ENST00000355528	ENST00000590282	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002542618	0.99745744
ENST00000355528	ENST00000443272	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.003436186	0.99656385
ENST00000539345	ENST00000589123	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.000433205	0.99956673
ENST00000539345	ENST00000346156	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002751979	0.997248
ENST00000539345	ENST00000395111	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002400557	0.9975994
ENST00000539345	ENST00000586919	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.00282761	0.9971724
ENST00000539345	ENST00000341919	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002053007	0.99794704
ENST00000539345	ENST00000590282	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.002453207	0.99754673
ENST00000539345	ENST00000443272	TBCD	chr17	80899359	+	NFIC	chr19	3381709	+	0.001891106	0.99810886

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TBCD-NFIC

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TBCD	chr17	80899359	NFIC	chr19	3381709	3694	1187	CDLLGVPRPQLVPQDEFHPFIEALLP
TBCD	chr17	80899359	NFIC	chr19	3381709	3714	1225	CDLLGVPRPQLVPQDEFHPFIEALLP

Top

Potential FusionNeoAntigen Information of TBCD-NFIC in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TBCD-NFIC_80899359_3381709.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:01	VPQDEFHPF	0.9969	0.9594	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:08	VPQDEFHPF	0.9932	0.9531	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:05	VPQDEFHPF	0.9921	0.8315	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B15:02	VPQDEFHPF	0.9816	0.971	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:03	VPQDEFHPF	0.9623	0.9575	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:02	VPQDEFHPF	0.8272	0.9826	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:04	VPQDEFHPF	0.8272	0.9826	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:08	LVPQDEFHPF	0.9819	0.964	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:05	LVPQDEFHPF	0.9772	0.866	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B07:02	RPQLVPQDEF	0.9758	0.5044	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:01	LVPQDEFHPF	0.965	0.9698	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B53:01	LVPQDEFHPF	0.9191	0.6135	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:08	RPQLVPQDEF	0.8513	0.8776	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B82:01	RPQLVPQDEF	0.4191	0.5116	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B13:01	RPQLVPQDEF	0.1583	0.9423	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B15:31	VPQDEFHPF	0.9964	0.9575	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:12	VPQDEFHPF	0.8272	0.9826	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B07:12	VPQDEFHPF	0.8155	0.6797	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B78:01	VPQDEFHPF	0.7029	0.5661	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B42:02	VPQDEFHPF	0.4836	0.7053	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B39:10	VPQDEFHPF	0.4416	0.953	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B42:01	VPQDEFHPF	0.4118	0.6972	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B07:12	RPQLVPQDEF	0.9708	0.6707	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B42:02	RPQLVPQDEF	0.6098	0.7835	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B42:01	RPQLVPQDEF	0.5428	0.778	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:77	VPQDEFHPF	0.9969	0.9594	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:23	VPQDEFHPF	0.9967	0.9629	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:20	VPQDEFHPF	0.996	0.9787	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:17	VPQDEFHPF	0.9935	0.9205	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:30	VPQDEFHPF	0.9935	0.9205	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:24	VPQDEFHPF	0.9922	0.9744	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:11	VPQDEFHPF	0.9858	0.9637	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B53:02	VPQDEFHPF	0.9639	0.5821	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B07:09	VPRPQLVPQ	0.9619	0.6458	5	14
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:13	VPQDEFHPF	0.9463	0.96	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B15:13	VPQDEFHPF	0.9067	0.7857	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:09	VPQDEFHPF	0.8272	0.9826	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B18:04	VPQDEFHPF	0.7871	0.9671	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B78:02	VPQDEFHPF	0.777	0.7201	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B18:07	VPQDEFHPF	0.6009	0.9523	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B18:03	VPQDEFHPF	0.5012	0.9589	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B18:08	VPQDEFHPF	0.4893	0.9551	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B67:01	VPQDEFHPF	0.4612	0.8807	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B15:08	VPQDEFHPF	0.4194	0.9451	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:43	VPQDEFHPF	0.4061	0.9474	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B15:11	VPQDEFHPF	0.4052	0.9467	11	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:30	LVPQDEFHPF	0.9805	0.9409	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:17	LVPQDEFHPF	0.9805	0.9409	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B07:22	RPQLVPQDEF	0.9758	0.5044	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:23	LVPQDEFHPF	0.9684	0.9709	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:77	LVPQDEFHPF	0.965	0.9698	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B35:24	LVPQDEFHPF	0.9335	0.9764	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B53:02	LVPQDEFHPF	0.8653	0.746	10	20
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B55:04	RPQLVPQDEF	0.5217	0.5852	7	17
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	HLA-B82:02	RPQLVPQDEF	0.4191	0.5116	7	17

Top

Potential FusionNeoAntigen Information of TBCD-NFIC in HLA II

TBCD-NFIC_80899359_3381709.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TBCD-NFIC	chr17	80899359	chr19	3381709	3694	DRB1-1529	VPQDEFHPFIEALLP	11	26

Top

Fusion breakpoint peptide structures of TBCD-NFIC

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6955	PRPQLVPQDEFHPF	TBCD	NFIC	chr17	80899359	chr19	3381709	3694

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TBCD-NFIC

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6955	PRPQLVPQDEFHPF	-7.15543	-7.26883
HLA-B14:02	3BVN	6955	PRPQLVPQDEFHPF	-4.77435	-5.80965
HLA-B52:01	3W39	6955	PRPQLVPQDEFHPF	-6.80875	-6.92215
HLA-B52:01	3W39	6955	PRPQLVPQDEFHPF	-4.20386	-5.23916
HLA-A11:01	4UQ2	6955	PRPQLVPQDEFHPF	-7.5194	-8.5547
HLA-A11:01	4UQ2	6955	PRPQLVPQDEFHPF	-6.9601	-7.0735
HLA-A24:02	5HGA	6955	PRPQLVPQDEFHPF	-7.52403	-7.63743
HLA-A24:02	5HGA	6955	PRPQLVPQDEFHPF	-5.82433	-6.85963
HLA-B27:05	6PYJ	6955	PRPQLVPQDEFHPF	-3.28285	-4.31815
HLA-B44:05	3DX8	6955	PRPQLVPQDEFHPF	-5.91172	-6.94702
HLA-B44:05	3DX8	6955	PRPQLVPQDEFHPF	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of TBCD-NFIC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TBCD-NFIC	chr17	80899359	chr19	3381709	10	20	LVPQDEFHPF	GTGCCCCAGGATGAGTTCCACCCGTTCATC
TBCD-NFIC	chr17	80899359	chr19	3381709	11	20	VPQDEFHPF	CCCCAGGATGAGTTCCACCCGTTCATC
TBCD-NFIC	chr17	80899359	chr19	3381709	5	14	VPRPQLVPQ	CCCAGGCCCCAGCTGGTGCCCCAGGAT
TBCD-NFIC	chr17	80899359	chr19	3381709	7	17	RPQLVPQDEF	CCCCAGCTGGTGCCCCAGGATGAGTTCCAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TBCD-NFIC	chr17	80899359	chr19	3381709	11	26	VPQDEFHPFIEALLP	CCCCAGGATGAGTTCCACCCGTTCATCGAGGCCCTGCTGCCTCAC

Top

Information of the samples that have these potential fusion neoantigens of TBCD-NFIC

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	TBCD-NFIC	chr17	80899359	ENST00000355528	chr19	3381709	ENST00000341919	TCGA-AN-A0AM

Top

Potential target of CAR-T therapy development for TBCD-NFIC

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TBCD-NFIC

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TBCD-NFIC

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)