Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TBL1XR1-TP73

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TBL1XR1-TP73
	FusionPDB ID: 89567
	FusionGDB2.0 ID: 89567
		Hgene	Tgene
	Gene symbol	TBL1XR1	TP73
	Gene ID	79718	7161
	Gene name	TBL1X receptor 1	tumor protein p73
	Synonyms	C21\|DC42\|IRA1\|MRD41\|TBLR1	P73
	Cytomap	3q26.32	1p36.32
	Type of gene	protein-coding	protein-coding
	Description	F-box-like/WD repeat-containing protein TBL1XR1TBL1-related protein 1nuclear receptor co-repressor/HDAC3 complex subunitnuclear receptor corepressor/HDAC3 complex subunit TBLR1transducin beta like 1 X-linked receptor 1	tumor protein p73p53-like transcription factorp53-related protein
	Modification date	20200313	20200327
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000430069, ENST00000457928,	ENST00000378290, ENST00000346387, ENST00000354437, ENST00000357733, ENST00000378280, ENST00000378285, ENST00000378288, ENST00000378295, ENST00000603362, ENST00000604074, ENST00000604479,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	51 X 31 X 15=23715	1 X 2 X 1=2
	# samples	66	2
	** MAII score	log2(66/23715*10)=-5.16719003372107 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/2*10)=3.32192809488736
Fusion gene context	PubMed: TBL1XR1 [Title/Abstract] AND TP73 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TBL1XR1 [Title/Abstract] AND TP73 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TBL1XR1(176771561)-TP73(3624113), # samples:3
Anticipated loss of major functional domain due to fusion event.	TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. TBL1XR1-TP73 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TBL1XR1	GO:0000122	negative regulation of transcription by RNA polymerase II	12628926
Hgene	TBL1XR1	GO:0045893	positive regulation of transcription, DNA-templated	18193033
Hgene	TBL1XR1	GO:0045944	positive regulation of transcription by RNA polymerase II	18193033
Tgene	TP73	GO:0006974	cellular response to DNA damage stimulus	18174154
Tgene	TP73	GO:0042771	intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator	18174154\|19490146
Tgene	TP73	GO:0045893	positive regulation of transcription, DNA-templated	15678106\|16343436
Tgene	TP73	GO:0045944	positive regulation of transcription by RNA polymerase II	16343436\|18174154\|18421303\|19490146\|24652652
Tgene	TP73	GO:0071158	positive regulation of cell cycle arrest	18421303

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:176771561/chr1:3624113)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TBL1XR1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TP73 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000378295	TP73	chr1	3624113	+	5311	464	260	2188	642
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000604074	TP73	chr1	3624113	+	4929	464	260	1489	409
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000354437	TP73	chr1	3624113	+	2308	464	260	1777	505
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000346387	TP73	chr1	3624113	+	2725	464	260	1900	546
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000357733	TP73	chr1	3624113	+	2770	464	260	1945	561
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000603362	TP73	chr1	3624113	+	1946	464	260	1945	562
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000604479	TP73	chr1	3624113	+	1901	464	260	1900	547
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000378285	TP73	chr1	3624113	+	2308	464	260	1777	505
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000378280	TP73	chr1	3624113	+	2253	464	260	1705	481
ENST00000430069	TBL1XR1	chr3	176771561	-	ENST00000378288	TP73	chr1	3624113	+	5311	464	260	2188	642
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000378295	TP73	chr1	3624112	+	5311	464	260	2188	642
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000604074	TP73	chr1	3624112	+	4929	464	260	1489	409
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000354437	TP73	chr1	3624112	+	2308	464	260	1777	505
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000346387	TP73	chr1	3624112	+	2725	464	260	1900	546
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000357733	TP73	chr1	3624112	+	2770	464	260	1945	561
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000603362	TP73	chr1	3624112	+	1946	464	260	1945	562
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000604479	TP73	chr1	3624112	+	1901	464	260	1900	547
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000378285	TP73	chr1	3624112	+	2308	464	260	1777	505
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000378280	TP73	chr1	3624112	+	2253	464	260	1705	481
ENST00000430069	TBL1XR1	chr3	176771560	-	ENST00000378288	TP73	chr1	3624112	+	5311	464	260	2188	642

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000430069	ENST00000378295	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.014324423	0.98567563
ENST00000430069	ENST00000604074	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.015070235	0.98492974
ENST00000430069	ENST00000354437	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.009571407	0.99042857
ENST00000430069	ENST00000346387	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.01749788	0.9825021
ENST00000430069	ENST00000357733	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.019354513	0.9806455
ENST00000430069	ENST00000603362	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.006527185	0.99347275
ENST00000430069	ENST00000604479	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.009883509	0.99011654
ENST00000430069	ENST00000378285	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.009571407	0.99042857
ENST00000430069	ENST00000378280	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.012137562	0.98786247
ENST00000430069	ENST00000378288	TBL1XR1	chr3	176771561	-	TP73	chr1	3624113	+	0.014324423	0.98567563
ENST00000430069	ENST00000378295	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.014324423	0.98567563
ENST00000430069	ENST00000604074	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.015070235	0.98492974
ENST00000430069	ENST00000354437	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.009571407	0.99042857
ENST00000430069	ENST00000346387	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.01749788	0.9825021
ENST00000430069	ENST00000357733	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.019354513	0.9806455
ENST00000430069	ENST00000603362	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.006527185	0.99347275
ENST00000430069	ENST00000604479	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.009883509	0.99011654
ENST00000430069	ENST00000378285	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.009571407	0.99042857
ENST00000430069	ENST00000378280	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.012137562	0.98786247
ENST00000430069	ENST00000378288	TBL1XR1	chr3	176771560	-	TP73	chr1	3624112	+	0.014324423	0.98567563

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TBL1XR1-TP73

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TBL1XR1	chr3	176771560	TP73	chr1	3624112	464	68	GLQYVEAEVSINEAQFNLLSSTMDQM
TBL1XR1	chr3	176771561	TP73	chr1	3624113	464	68	GLQYVEAEVSINEAQFNLLSSTMDQM

Top

Potential FusionNeoAntigen Information of TBL1XR1-TP73 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TBL1XR1-TP73_176771560_3624112.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:02	AEVSINEA	0.9999	0.5826	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B45:01	AEVSINEA	0.9998	0.8465	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:01	NEAQFNLL	0.9877	0.7047	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B41:01	AEVSINEA	0.9676	0.8528	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:01	AEVSINEA	0.9626	0.7636	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:38	SINEAQFNL	0.9919	0.6038	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:21	SINEAQFNL	0.9856	0.7298	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:29	SINEAQFNL	0.9842	0.5631	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:35	SINEAQFNL	0.983	0.5932	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:30	SINEAQFNL	0.9821	0.5649	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:24	SINEAQFNL	0.9821	0.5649	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:67	SINEAQFNL	0.9821	0.5649	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:60	SINEAQFNL	0.9813	0.5507	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:20	SINEAQFNL	0.9812	0.5639	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:11	SINEAQFNL	0.9809	0.5993	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:27	SINEAQFNL	0.9776	0.5364	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:04	SINEAQFNL	0.9768	0.5345	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:13	SINEAQFNL	0.9704	0.6588	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B45:01	NEAQFNLLS	0.9684	0.7307	11	20
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B13:01	SINEAQFNL	0.1743	0.7781	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B44:03	AEVSINEAQF	0.9994	0.884	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B45:01	VEAEVSINEA	0.9955	0.8865	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:02	VEAEVSINEA	0.9917	0.5769	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:01	VEAEVSINEA	0.9156	0.7713	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B41:01	VEAEVSINEA	0.8615	0.8913	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B40:06	AEVSINEA	0.9998	0.73	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-C04:06	SINEAQFNL	0.9973	0.929	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:07	SINEAQFNL	0.9836	0.5903	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:01	SINEAQFNL	0.9821	0.5649	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-C02:06	SINEAQFNL	0.7069	0.9664	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B40:06	VEAEVSINEA	0.989	0.6967	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B40:04	NEAQFNLL	0.9986	0.5308	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:05	NEAQFNLL	0.9877	0.7047	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:08	NEAQFNLL	0.9864	0.6469	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:03	NEAQFNLL	0.9855	0.6907	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:06	NEAQFNLL	0.9847	0.7101	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:04	AEVSINEA	0.9626	0.7636	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:05	AEVSINEA	0.9626	0.7636	6	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:11	NEAQFNLL	0.9408	0.6888	11	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-C15:05	SINEAQFNL	0.9989	0.9459	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-C15:02	SINEAQFNL	0.9984	0.9232	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A25:01	EVSINEAQF	0.9974	0.7526	7	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:14	SINEAQFNL	0.9863	0.5603	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A02:06	SINEAQFNL	0.9856	0.7298	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A69:01	SINEAQFNL	0.9534	0.7376	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-A32:01	SINEAQFNL	0.9038	0.9484	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B15:73	SINEAQFNL	0.7545	0.8775	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-C17:01	SINEAQFNL	0.5849	0.9126	9	18
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B15:08	EVSINEAQF	0.5325	0.7206	7	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B44:13	AEVSINEAQF	0.9994	0.884	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B44:07	AEVSINEAQF	0.9994	0.884	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B44:26	AEVSINEAQF	0.9994	0.884	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B40:04	AEVSINEAQF	0.9924	0.5785	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B15:53	AEVSINEAQF	0.9748	0.7556	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B18:11	AEVSINEAQF	0.9709	0.7974	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B48:02	AEVSINEAQF	0.9244	0.7753	6	16
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:05	VEAEVSINEA	0.9156	0.7713	4	14
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	HLA-B50:04	VEAEVSINEA	0.9156	0.7713	4	14

Top

Potential FusionNeoAntigen Information of TBL1XR1-TP73 in HLA II

TBL1XR1-TP73_176771560_3624112.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0405	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0417	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0424	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0424	INEAQFNLLSSTMDQ	10	25
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0429	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0430	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0445	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0448	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0457	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0477	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0480	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0483	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0484	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-0489	NEAQFNLLSSTMDQM	11	26
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-1001	GLQYVEAEVSINEAQ	0	15
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB1-1003	GLQYVEAEVSINEAQ	0	15
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0201	EAEVSINEAQFNLLS	5	20
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0201	VEAEVSINEAQFNLL	4	19
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0204	EAEVSINEAQFNLLS	5	20
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0214	EAEVSINEAQFNLLS	5	20
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0224	EAEVSINEAQFNLLS	5	20
TBL1XR1-TP73	chr3	176771560	chr1	3624112	464	DRB3-0224	VEAEVSINEAQFNLL	4	19

Top

Fusion breakpoint peptide structures of TBL1XR1-TP73

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
184	AEVSINEAQFNLLS	TBL1XR1	TP73	chr3	176771560	chr1	3624112	464

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TBL1XR1-TP73

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	184	AEVSINEAQFNLLS	-7.9962	-8.1096
HLA-B14:02	3BVN	184	AEVSINEAQFNLLS	-5.70842	-6.74372
HLA-B52:01	3W39	184	AEVSINEAQFNLLS	-6.83737	-6.95077
HLA-B52:01	3W39	184	AEVSINEAQFNLLS	-4.4836	-5.5189
HLA-A11:01	4UQ2	184	AEVSINEAQFNLLS	-10.0067	-10.1201
HLA-A11:01	4UQ2	184	AEVSINEAQFNLLS	-9.03915	-10.0745
HLA-A24:02	5HGA	184	AEVSINEAQFNLLS	-6.56204	-6.67544
HLA-A24:02	5HGA	184	AEVSINEAQFNLLS	-5.42271	-6.45801
HLA-B44:05	3DX8	184	AEVSINEAQFNLLS	-7.85648	-8.89178
HLA-B44:05	3DX8	184	AEVSINEAQFNLLS	-5.3978	-5.5112
HLA-A02:01	6TDR	184	AEVSINEAQFNLLS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TBL1XR1-TP73

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TBL1XR1-TP73	chr3	176771560	chr1	3624112	11	19	NEAQFNLL	AATGAGGCCCAGTTCAATCTGCTG
TBL1XR1-TP73	chr3	176771560	chr1	3624112	11	20	NEAQFNLLS	AATGAGGCCCAGTTCAATCTGCTGAGC
TBL1XR1-TP73	chr3	176771560	chr1	3624112	4	14	VEAEVSINEA	GTAGAAGCAGAAGTTAGTATTAATGAGGCC
TBL1XR1-TP73	chr3	176771560	chr1	3624112	6	14	AEVSINEA	GCAGAAGTTAGTATTAATGAGGCC
TBL1XR1-TP73	chr3	176771560	chr1	3624112	6	16	AEVSINEAQF	GCAGAAGTTAGTATTAATGAGGCCCAGTTC
TBL1XR1-TP73	chr3	176771560	chr1	3624112	7	16	EVSINEAQF	GAAGTTAGTATTAATGAGGCCCAGTTC
TBL1XR1-TP73	chr3	176771560	chr1	3624112	9	18	SINEAQFNL	AGTATTAATGAGGCCCAGTTCAATCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TBL1XR1-TP73	chr3	176771560	chr1	3624112	0	15	GLQYVEAEVSINEAQ	GGTCTACAGTATGTAGAAGCAGAAGTTAGTATTAATGAGGCCCAG
TBL1XR1-TP73	chr3	176771560	chr1	3624112	10	25	INEAQFNLLSSTMDQ	ATTAATGAGGCCCAGTTCAATCTGCTGAGCAGCACCATGGACCAG
TBL1XR1-TP73	chr3	176771560	chr1	3624112	11	26	NEAQFNLLSSTMDQM	AATGAGGCCCAGTTCAATCTGCTGAGCAGCACCATGGACCAGATG
TBL1XR1-TP73	chr3	176771560	chr1	3624112	4	19	VEAEVSINEAQFNLL	GTAGAAGCAGAAGTTAGTATTAATGAGGCCCAGTTCAATCTGCTG
TBL1XR1-TP73	chr3	176771560	chr1	3624112	5	20	EAEVSINEAQFNLLS	GAAGCAGAAGTTAGTATTAATGAGGCCCAGTTCAATCTGCTGAGC

Top

Information of the samples that have these potential fusion neoantigens of TBL1XR1-TP73

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
DLBC	TBL1XR1-TP73	chr3	176771560	ENST00000430069	chr1	3624112	ENST00000346387	TCGA-FA-A4XK

Top

Potential target of CAR-T therapy development for TBL1XR1-TP73

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TBL1XR1-TP73

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TBL1XR1-TP73

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)