Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BANP-JPH3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BANP-JPH3
	FusionPDB ID: 8958
	FusionGDB2.0 ID: 8958
		Hgene	Tgene
	Gene symbol	BANP	JPH3
	Gene ID	54971	57338
	Gene name	BTG3 associated nuclear protein	junctophilin 3
	Synonyms	BEND1\|SMAR1\|SMARBP1	CAGL237\|HDL2\|JP-3\|JP3\|TNRC22
	Cytomap	16q24.2	16q24.2
	Type of gene	protein-coding	protein-coding
	Description	protein BANPBEN domain-containing protein 1scaffold/matrix-associated region-1-binding protein	junctophilin-3junctophilin type 3trinucleotide repeat containing 22
	Modification date	20200315	20200314
	UniProtAcc	Q8N9N5 Main function of 5'-partner protein: FUNCTION: Controls V(D)J recombination during T-cell development by repressing T-cell receptor (TCR) beta enhancer function. Binds to scaffold/matrix attachment region beta (S/MARbeta), an ATC-rich DNA sequence located upstream of the TCR beta enhancer. Represses cyclin D1 transcription by recruiting HDAC1 to its promoter, thereby diminishing H3K9ac, H3S10ph and H4K8ac levels. Promotes TP53 'Ser-15' phosphorylation and nuclear accumulation, which causes cell cycle arrest (By similarity). {ECO:0000250, ECO:0000269\|PubMed:16166625}.	Q8WXH2 Main function of 5'-partner protein: FUNCTION: Junctophilins contribute to the formation of junctional membrane complexes (JMCs) which link the plasma membrane with the endoplasmic or sarcoplasmic reticulum in excitable cells. Provides a structural foundation for functional cross-talk between the cell surface and intracellular calcium release channels. JPH3 is brain-specific and appears to have an active role in certain neurons involved in motor coordination and memory.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000286122, ENST00000355022, ENST00000355163, ENST00000393207, ENST00000393208, ENST00000479780, ENST00000538234, ENST00000481948,	ENST00000563609, ENST00000284262,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 7 X 8=448	4 X 3 X 4=48
	# samples	8	4
	** MAII score	log2(8/448*10)=-2.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BANP [Title/Abstract] AND JPH3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BANP [Title/Abstract] AND JPH3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BANP(88052273)-JPH3(87677864), # samples:3
Anticipated loss of major functional domain due to fusion event.	BANP-JPH3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BANP-JPH3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BANP-JPH3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BANP-JPH3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr16:88052273/chr16:87677864)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BANP (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across JPH3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000286122	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4384	1023	152	2887	911
ENST00000355163	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4309	948	152	2812	886
ENST00000479780	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4289	928	150	2792	880
ENST00000393208	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4289	928	150	2792	880
ENST00000355022	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4236	875	97	2739	880
ENST00000538234	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4447	1086	191	2950	919
ENST00000393207	BANP	chr16	88052273	+	ENST00000284262	JPH3	chr16	87677864	+	4453	1092	221	2956	911

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000286122	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.004904692	0.9950954
ENST00000355163	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.007808432	0.9921916
ENST00000479780	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.007165356	0.9928347
ENST00000393208	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.007165356	0.9928347
ENST00000355022	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.007139639	0.9928604
ENST00000538234	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.00502544	0.9949746
ENST00000393207	ENST00000284262	BANP	chr16	88052273	+	JPH3	chr16	87677864	+	0.004559794	0.9954401

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BANP-JPH3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BANP	chr16	88052273	JPH3	chr16	87677864	1023	291	KQLDPLTIYGIRWTYQGQWVGGMRQG
BANP	chr16	88052273	JPH3	chr16	87677864	1086	299	KQLDPLTIYGIRWTYQGQWVGGMRQG
BANP	chr16	88052273	JPH3	chr16	87677864	1092	291	KQLDPLTIYGIRWTYQGQWVGGMRQG
BANP	chr16	88052273	JPH3	chr16	87677864	875	260	KQLDPLTIYGIRWTYQGQWVGGMRQG
BANP	chr16	88052273	JPH3	chr16	87677864	928	260	KQLDPLTIYGIRWTYQGQWVGGMRQG
BANP	chr16	88052273	JPH3	chr16	87677864	948	266	KQLDPLTIYGIRWTYQGQWVGGMRQG

Top

Potential FusionNeoAntigen Information of BANP-JPH3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BANP-JPH3_88052273_87677864.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:02	IRWTYQGQW	0.9984	0.5633	10	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:05	IRWTYQGQW	0.9971	0.759	10	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:04	IRWTYQGQW	0.9968	0.7402	10	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:02	TIYGIRWTY	0.9933	0.9397	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:25	TIYGIRWTY	0.9923	0.9303	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:08	TIYGIRWTY	0.9837	0.8355	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:01	TIYGIRWTY	0.9823	0.8995	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:17	TIYGIRWTY	0.9747	0.9076	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:05	TIYGIRWTY	0.9633	0.5606	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:01	TIYGIRWTY	0.9538	0.9038	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:16	TIYGIRWTY	0.8869	0.7863	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-A32:13	TIYGIRWTY	0.7726	0.8908	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B57:01	LTIYGIRWTY	0.9987	0.9296	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:17	LTIYGIRWTY	0.9942	0.8599	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:16	LTIYGIRWTY	0.961	0.7285	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:02	YGIRWTYQGQW	0.9839	0.5233	8	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:21	TIYGIRWTY	0.9925	0.9043	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:07	TIYGIRWTY	0.9807	0.6073	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:03	IRWTYQGQW	0.9756	0.7712	10	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:05	TIYGIRWTY	0.9671	0.8982	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:31	TIYGIRWTY	0.9525	0.9069	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:04	TIYGIRWTY	0.8442	0.9356	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C15:04	TIYGIRWTY	0.6336	0.9025	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C03:14	TIYGIRWTY	0.2541	0.9665	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C12:04	TIYGIRWTY	0.1953	0.9794	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:03	GIRWTYQGQW	0.4542	0.606	9	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C14:02	IYGIRWTY	0.5545	0.8567	7	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C14:03	IYGIRWTY	0.5545	0.8567	7	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B27:10	IRWTYQGQW	0.9964	0.8006	10	19
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:11	TIYGIRWTY	0.9922	0.9031	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:39	TIYGIRWTY	0.9916	0.8636	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:50	TIYGIRWTY	0.9872	0.8843	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:27	TIYGIRWTY	0.9843	0.9098	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:35	TIYGIRWTY	0.9826	0.8871	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:125	TIYGIRWTY	0.9823	0.8995	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:33	TIYGIRWTY	0.9823	0.8995	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:34	TIYGIRWTY	0.9823	0.8995	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:135	TIYGIRWTY	0.9809	0.9171	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:30	TIYGIRWTY	0.9751	0.7618	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:17	TIYGIRWTY	0.9751	0.7618	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:11	TIYGIRWTY	0.9746	0.8328	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:20	TIYGIRWTY	0.9691	0.9308	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:08	TIYGIRWTY	0.9691	0.8205	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:13	TIYGIRWTY	0.9658	0.666	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:43	TIYGIRWTY	0.962	0.8192	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:24	TIYGIRWTY	0.9619	0.9298	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:23	TIYGIRWTY	0.9551	0.9073	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:77	TIYGIRWTY	0.9538	0.9038	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:20	TIYGIRWTY	0.951	0.9319	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B15:12	TIYGIRWTY	0.9453	0.8329	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:28	TIYGIRWTY	0.9425	0.9276	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-A32:01	TIYGIRWTY	0.9101	0.7812	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-A25:01	TIYGIRWTY	0.8873	0.7576	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B35:24	TIYGIRWTY	0.8823	0.9179	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C03:02	TIYGIRWTY	0.6933	0.9594	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C15:09	TIYGIRWTY	0.6336	0.9025	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C16:04	TIYGIRWTY	0.5729	0.9289	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C12:02	TIYGIRWTY	0.4754	0.9263	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B18:04	TIYGIRWTY	0.4047	0.9176	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C12:03	TIYGIRWTY	0.3698	0.9304	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B18:07	TIYGIRWTY	0.1868	0.8382	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B18:08	TIYGIRWTY	0.1545	0.6467	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C02:10	TIYGIRWTY	0.0094	0.933	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-C02:02	TIYGIRWTY	0.0094	0.933	6	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B57:10	LTIYGIRWTY	0.9987	0.9296	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-B57:04	LTIYGIRWTY	0.9974	0.6485	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-A32:01	LTIYGIRWTY	0.7672	0.9052	5	15
BANP-JPH3	chr16	88052273	chr16	87677864	1023	HLA-A25:01	LTIYGIRWTY	0.6207	0.7802	5	15

Top

Potential FusionNeoAntigen Information of BANP-JPH3 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of BANP-JPH3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9420	TIYGIRWTYQGQWV	BANP	JPH3	chr16	88052273	chr16	87677864	1023

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BANP-JPH3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9420	TIYGIRWTYQGQWV	-7.19905	-7.31085
HLA-B14:02	3BVN	9420	TIYGIRWTYQGQWV	-4.95643	-5.99953
HLA-B52:01	3W39	9420	TIYGIRWTYQGQWV	-5.83545	-5.94725
HLA-B52:01	3W39	9420	TIYGIRWTYQGQWV	-5.05006	-6.09316
HLA-A24:02	5HGA	9420	TIYGIRWTYQGQWV	-7.70134	-7.81314
HLA-A24:02	5HGA	9420	TIYGIRWTYQGQWV	-3.44118	-4.48428
HLA-B27:05	6PYJ	9420	TIYGIRWTYQGQWV	-9.10792	-9.21972
HLA-B44:05	3DX8	9420	TIYGIRWTYQGQWV	-4.82059	-4.93239
HLA-B44:05	3DX8	9420	TIYGIRWTYQGQWV	-3.88198	-4.92508
HLA-A02:01	6TDR	9420	TIYGIRWTYQGQWV	-2.45382	-2.56562

Top

Vaccine Design for the FusionNeoAntigens of BANP-JPH3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BANP-JPH3	chr16	88052273	chr16	87677864	10	19	IRWTYQGQW	GCATCCGGTGGACCTACCAGGGCCAGT
BANP-JPH3	chr16	88052273	chr16	87677864	5	15	LTIYGIRWTY	CGCTCACCATCTACGGCATCCGGTGGACCT
BANP-JPH3	chr16	88052273	chr16	87677864	6	15	TIYGIRWTY	TCACCATCTACGGCATCCGGTGGACCT
BANP-JPH3	chr16	88052273	chr16	87677864	7	15	IYGIRWTY	CCATCTACGGCATCCGGTGGACCT
BANP-JPH3	chr16	88052273	chr16	87677864	8	19	YGIRWTYQGQW	TCTACGGCATCCGGTGGACCTACCAGGGCCAGT
BANP-JPH3	chr16	88052273	chr16	87677864	9	19	GIRWTYQGQW	ACGGCATCCGGTGGACCTACCAGGGCCAGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of BANP-JPH3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	BANP-JPH3	chr16	88052273	ENST00000286122	chr16	87677864	ENST00000284262	TCGA-ER-A1A1-06A

Top

Potential target of CAR-T therapy development for BANP-JPH3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

JPH3

chr16:88052273

chr16:87677864

ENST00000284262

728_748

749.0

Transmembrane

Helical%3B Anchor for type IV membrane protein

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BANP-JPH3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BANP-JPH3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)