![]() |
|||||||
|
Fusion Protein:TBX3-RRM1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: TBX3-RRM1 | FusionPDB ID: 89620 | FusionGDB2.0 ID: 89620 | Hgene | Tgene | Gene symbol | TBX3 | RRM1 | Gene ID | 6926 | 6240 |
Gene name | T-box transcription factor 3 | ribonucleotide reductase catalytic subunit M1 | |
Synonyms | TBX3-ISO|UMS|XHL | R1|RIR1|RR1 | |
Cytomap | 12q24.21 | 11p15.4 | |
Type of gene | protein-coding | protein-coding | |
Description | T-box transcription factor TBX3T-box 3T-box protein 3bladder cancer related protein XHL | ribonucleoside-diphosphate reductase large subunitribonucleoside-diphosphate reductase subunit M1ribonucleotide reductase M1 polypeptideribonucleotide reductase, R1 subunit | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000257566, ENST00000349155, | ENST00000423050, ENST00000528470, ENST00000534285, ENST00000537197, ENST00000300738, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 4 X 3=48 | 7 X 6 X 4=168 |
# samples | 4 | 7 | |
** MAII score | log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: TBX3 [Title/Abstract] AND RRM1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TBX3 [Title/Abstract] AND RRM1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TBX3(115118684)-RRM1(4127276), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | TBX3-RRM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBX3-RRM1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TBX3-RRM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TBX3-RRM1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TBX3 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 11689487 |
Hgene | TBX3 | GO:0007569 | cell aging | 11689487|11748239 |
Hgene | TBX3 | GO:0008284 | positive regulation of cell proliferation | 11689487|11748239|12032820 |
Hgene | TBX3 | GO:0009887 | animal organ morphogenesis | 9207801 |
Hgene | TBX3 | GO:0035136 | forelimb morphogenesis | 9207801 |
Hgene | TBX3 | GO:0043066 | negative regulation of apoptotic process | 12032820 |
Hgene | TBX3 | GO:0045662 | negative regulation of myoblast differentiation | 12032820 |
Hgene | TBX3 | GO:0045787 | positive regulation of cell cycle | 12032820 |
Hgene | TBX3 | GO:0045892 | negative regulation of transcription, DNA-templated | 10468588|11689487 |
Hgene | TBX3 | GO:0090398 | cellular senescence | 22002537 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:115118684/chr11:4127276) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000349155 | TBX3 | chr12 | 115118684 | - | ENST00000300738 | RRM1 | chr11 | 4127276 | + | 4385 | 1621 | 865 | 3891 | 1008 |
ENST00000257566 | TBX3 | chr12 | 115118684 | - | ENST00000300738 | RRM1 | chr11 | 4127276 | + | 3811 | 1047 | 291 | 3317 | 1008 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000349155 | ENST00000300738 | TBX3 | chr12 | 115118684 | - | RRM1 | chr11 | 4127276 | + | 0.000947212 | 0.9990528 |
ENST00000257566 | ENST00000300738 | TBX3 | chr12 | 115118684 | - | RRM1 | chr11 | 4127276 | + | 0.000506112 | 0.99949384 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TBX3-RRM1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TBX3 | chr12 | 115118684 | RRM1 | chr11 | 4127276 | 1047 | 252 | LKLTNNISDKHGFAQITMKVIQGLYS |
TBX3 | chr12 | 115118684 | RRM1 | chr11 | 4127276 | 1621 | 252 | LKLTNNISDKHGFAQITMKVIQGLYS |
Top |
Potential FusionNeoAntigen Information of TBX3-RRM1 in HLA I |
![]() |
TBX3-RRM1_115118684_4127276.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:01 | KHGFAQITM | 0.9965 | 0.9575 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:24 | KHGFAQITM | 0.9945 | 0.8086 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B38:02 | KHGFAQITM | 0.9863 | 0.9921 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B38:01 | KHGFAQITM | 0.9846 | 0.9931 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B15:10 | KHGFAQITM | 0.8611 | 0.6194 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B15:18 | KHGFAQITM | 0.743 | 0.8249 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B15:37 | KHGFAQITM | 0.2626 | 0.6418 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B15:37 | DKHGFAQITM | 0.948 | 0.5449 | 8 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B51:07 | FAQITMKV | 0.9963 | 0.8337 | 12 | 20 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:07 | FAQITMKVI | 0.9987 | 0.9843 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:09 | KHGFAQITM | 0.9968 | 0.8316 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:19 | FAQITMKVI | 0.9952 | 0.9923 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:05 | KHGFAQITM | 0.9869 | 0.9511 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:08 | FAQITMKVI | 0.9812 | 0.9401 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C12:12 | FAQITMKVI | 0.9776 | 0.945 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C12:04 | FAQITMKVI | 0.9713 | 0.9971 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B51:07 | FAQITMKVI | 0.9438 | 0.8125 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:05 | FAQITMKVI | 0.9984 | 0.9535 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:17 | FAQITMKVI | 0.9978 | 0.979 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:31 | KHGFAQITM | 0.9942 | 0.9593 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:04 | FAQITMKVI | 0.9934 | 0.9921 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C03:03 | FAQITMKVI | 0.9934 | 0.9921 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B38:05 | KHGFAQITM | 0.9846 | 0.9931 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-A30:01 | HGFAQITMK | 0.977 | 0.8605 | 10 | 19 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C12:03 | FAQITMKVI | 0.9706 | 0.987 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B51:14 | FAQITMKVI | 0.9425 | 0.5029 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-C16:04 | FAQITMKVI | 0.941 | 0.9909 | 12 | 21 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B15:09 | KHGFAQITM | 0.7212 | 0.9468 | 9 | 18 |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 | HLA-B39:11 | KHGFAQITM | 0.6053 | 0.9269 | 9 | 18 |
Top |
Potential FusionNeoAntigen Information of TBX3-RRM1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of TBX3-RRM1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3982 | ISDKHGFAQITMKV | TBX3 | RRM1 | chr12 | 115118684 | chr11 | 4127276 | 1047 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TBX3-RRM1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3982 | ISDKHGFAQITMKV | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 3982 | ISDKHGFAQITMKV | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 3982 | ISDKHGFAQITMKV | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 3982 | ISDKHGFAQITMKV | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 3982 | ISDKHGFAQITMKV | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 3982 | ISDKHGFAQITMKV | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 3982 | ISDKHGFAQITMKV | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 3982 | ISDKHGFAQITMKV | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 3982 | ISDKHGFAQITMKV | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 3982 | ISDKHGFAQITMKV | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 3982 | ISDKHGFAQITMKV | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of TBX3-RRM1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 10 | 19 | HGFAQITMK | CATGGATTTGCTCAGATCACCATGAAA |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 12 | 20 | FAQITMKV | TTTGCTCAGATCACCATGAAAGTA |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 12 | 21 | FAQITMKVI | TTTGCTCAGATCACCATGAAAGTAATC |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 8 | 18 | DKHGFAQITM | GACAAACATGGATTTGCTCAGATCACCATG |
TBX3-RRM1 | chr12 | 115118684 | chr11 | 4127276 | 9 | 18 | KHGFAQITM | AAACATGGATTTGCTCAGATCACCATG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of TBX3-RRM1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
PRAD | TBX3-RRM1 | chr12 | 115118684 | ENST00000257566 | chr11 | 4127276 | ENST00000300738 | TCGA-HC-7818-01A |
Top |
Potential target of CAR-T therapy development for TBX3-RRM1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TBX3-RRM1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TBX3-RRM1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |