Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TF-ALB

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TF-ALB
	FusionPDB ID: 90250
	FusionGDB2.0 ID: 90250
		Hgene	Tgene
	Gene symbol	TF	ALB
	Gene ID	7018	213
	Gene name	transferrin	albumin
	Synonyms	HEL-S-71p\|PRO1557\|PRO2086\|TFQTL1	HSA\|PRO0883\|PRO0903\|PRO1341
	Cytomap	3q22.1	4q13.3
	Type of gene	protein-coding	protein-coding
	Description	serotransferrinbeta-1 metal-binding globulinepididymis secretory sperm binding protein Li 71psiderophilin	serum albumin
	Modification date	20200313	20200329
	UniProtAcc	GTF2A1L Main function of 5'-partner protein: 478	P02768 Main function of 5'-partner protein: FUNCTION: Binds water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs (Probable). Its main function is the regulation of the colloidal osmotic pressure of blood (Probable). Major zinc transporter in plasma, typically binds about 80% of all plasma zinc (PubMed:19021548). Major calcium and magnesium transporter in plasma, binds approximately 45% of circulating calcium and magnesium in plasma (By similarity). Potentially has more than two calcium-binding sites and might additionally bind calcium in a non-specific manner (By similarity). The shared binding site between zinc and calcium at residue Asp-273 suggests a crosstalk between zinc and calcium transport in the blood (By similarity). The rank order of affinity is zinc > calcium > magnesium (By similarity). Binds to the bacterial siderophore enterobactin and inhibits enterobactin-mediated iron uptake of E.coli from ferric transferrin, and may thereby limit the utilization of iron and growth of enteric bacteria such as E.coli (PubMed:6234017). Does not prevent iron uptake by the bacterial siderophore aerobactin (PubMed:6234017). {ECO:0000250\|UniProtKB:P02769, ECO:0000269\|PubMed:19021548, ECO:0000269\|PubMed:6234017, ECO:0000305\|PubMed:1630489}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000264998, ENST00000402696, ENST00000475382,	ENST00000505649, ENST00000295897, ENST00000401494, ENST00000415165, ENST00000503124, ENST00000509063,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	22 X 26 X 5=2860	49 X 62 X 5=15190
	# samples	28	64
	** MAII score	log2(28/2860*10)=-3.35251641472079 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(64/15190*10)=-4.56890615450208 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TF [Title/Abstract] AND ALB [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TF [Title/Abstract] AND ALB [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TF(133495892)-ALB(74280797), # samples:2 TF(133490670)-ALB(74279289), # samples:2 ALB(74283351)-TF(133497492), # samples:1 ALB(74272402)-TF(133495984), # samples:1 ALB(74285355)-TF(133475820), # samples:1 ALB(74283820)-TF(133497528), # samples:1
Anticipated loss of major functional domain due to fusion event.	ALB-TF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ALB-TF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TF-ALB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TF-ALB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TF-ALB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TF-ALB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ALB-TF seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ALB-TF seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ALB-TF seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. TF-ALB seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TF-ALB seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TF-ALB seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TF	GO:0048260	positive regulation of receptor-mediated endocytosis	12704209
Tgene	ALB	GO:0009267	cellular response to starvation	16245148
Tgene	ALB	GO:0043066	negative regulation of apoptotic process	16153637
Tgene	ALB	GO:0051659	maintenance of mitochondrion location	16153637

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:133495892/chr4:74280797)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TF (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ALB (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000402696	TF	chr3	133474300	-	ENST00000295897	ALB	chr4	74283329	+	1829	1026	377	1042	221
ENST00000402696	TF	chr3	133474300	-	ENST00000415165	ALB	chr4	74283329	+	1673	1026	377	1042	221
ENST00000402696	TF	chr3	133474300	-	ENST00000503124	ALB	chr4	74283329	+	1639	1026	377	1042	221
ENST00000402696	TF	chr3	133474300	-	ENST00000509063	ALB	chr4	74283329	+	1542	1026	377	1042	221
ENST00000402696	TF	chr3	133474300	-	ENST00000401494	ALB	chr4	74283329	+	1639	1026	377	1042	221
ENST00000264998	TF	chr3	133474300	-	ENST00000295897	ALB	chr4	74283329	+	1219	416	452	874	140
ENST00000264998	TF	chr3	133474300	-	ENST00000415165	ALB	chr4	74283329	+	1063	416	452	874	140
ENST00000264998	TF	chr3	133474300	-	ENST00000503124	ALB	chr4	74283329	+	1029	416	452	874	140
ENST00000264998	TF	chr3	133474300	-	ENST00000509063	ALB	chr4	74283329	+	932	416	452	859	135
ENST00000264998	TF	chr3	133474300	-	ENST00000401494	ALB	chr4	74283329	+	1029	416	452	874	140
ENST00000402696	TF	chr3	133478117	-	ENST00000295897	ALB	chr4	74283976	+	2163	1589	377	1660	427
ENST00000402696	TF	chr3	133478117	-	ENST00000415165	ALB	chr4	74283976	+	2007	1589	377	1660	427
ENST00000402696	TF	chr3	133478117	-	ENST00000503124	ALB	chr4	74283976	+	1973	1589	377	1660	427
ENST00000402696	TF	chr3	133478117	-	ENST00000509063	ALB	chr4	74283976	+	1876	1589	377	1660	427
ENST00000402696	TF	chr3	133478117	-	ENST00000401494	ALB	chr4	74283976	+	1973	1589	377	1660	427
ENST00000264998	TF	chr3	133478117	-	ENST00000295897	ALB	chr4	74283976	+	1553	979	115	1050	311
ENST00000264998	TF	chr3	133478117	-	ENST00000415165	ALB	chr4	74283976	+	1397	979	115	1050	311
ENST00000264998	TF	chr3	133478117	-	ENST00000503124	ALB	chr4	74283976	+	1363	979	115	1050	311
ENST00000264998	TF	chr3	133478117	-	ENST00000509063	ALB	chr4	74283976	+	1266	979	115	1050	311
ENST00000264998	TF	chr3	133478117	-	ENST00000401494	ALB	chr4	74283976	+	1363	979	115	1050	311
ENST00000402696	TF	chr3	133486980	+	ENST00000295897	ALB	chr4	74285331	+	2413	1999	377	2068	563
ENST00000402696	TF	chr3	133486980	+	ENST00000415165	ALB	chr4	74285331	+	2257	1999	377	2068	563
ENST00000402696	TF	chr3	133486980	+	ENST00000503124	ALB	chr4	74285331	+	2223	1999	377	2068	563
ENST00000402696	TF	chr3	133486980	+	ENST00000509063	ALB	chr4	74285331	+	2126	1999	377	2053	558
ENST00000402696	TF	chr3	133486980	+	ENST00000401494	ALB	chr4	74285331	+	2223	1999	377	2068	563
ENST00000264998	TF	chr3	133486980	+	ENST00000295897	ALB	chr4	74285331	+	1803	1389	115	1458	447
ENST00000264998	TF	chr3	133486980	+	ENST00000415165	ALB	chr4	74285331	+	1647	1389	115	1458	447
ENST00000264998	TF	chr3	133486980	+	ENST00000503124	ALB	chr4	74285331	+	1613	1389	115	1458	447
ENST00000264998	TF	chr3	133486980	+	ENST00000509063	ALB	chr4	74285331	+	1516	1389	115	1443	442
ENST00000264998	TF	chr3	133486980	+	ENST00000401494	ALB	chr4	74285331	+	1613	1389	115	1458	447

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000402696	ENST00000295897	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.003234007	0.996766
ENST00000402696	ENST00000415165	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.003451807	0.99654824
ENST00000402696	ENST00000503124	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.003751298	0.99624866
ENST00000402696	ENST00000509063	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.004102841	0.9958972
ENST00000402696	ENST00000401494	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.003751298	0.99624866
ENST00000264998	ENST00000295897	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.00407334	0.99592674
ENST00000264998	ENST00000415165	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.004748638	0.9952513
ENST00000264998	ENST00000503124	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.004439768	0.99556017
ENST00000264998	ENST00000509063	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.009187562	0.99081236
ENST00000264998	ENST00000401494	TF	chr3	133474300	-	ALB	chr4	74283329	+	0.004439768	0.99556017
ENST00000402696	ENST00000295897	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.001126961	0.99887305
ENST00000402696	ENST00000415165	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.001903555	0.9980964
ENST00000402696	ENST00000503124	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.002227016	0.997773
ENST00000402696	ENST00000509063	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.002459589	0.9975405
ENST00000402696	ENST00000401494	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.002227016	0.997773
ENST00000264998	ENST00000295897	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.00576684	0.9942332
ENST00000264998	ENST00000415165	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.010979075	0.9890209
ENST00000264998	ENST00000503124	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.012802327	0.9871977
ENST00000264998	ENST00000509063	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.014859315	0.9851407
ENST00000264998	ENST00000401494	TF	chr3	133478117	-	ALB	chr4	74283976	+	0.012802327	0.9871977
ENST00000402696	ENST00000295897	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.000606891	0.9993931
ENST00000402696	ENST00000415165	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.001011175	0.9989888
ENST00000402696	ENST00000503124	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.001254179	0.9987458
ENST00000402696	ENST00000509063	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.00140588	0.9985941
ENST00000402696	ENST00000401494	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.001254179	0.9987458
ENST00000264998	ENST00000295897	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.00188997	0.99811006
ENST00000264998	ENST00000415165	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.003566652	0.9964334
ENST00000264998	ENST00000503124	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.004864211	0.99513584
ENST00000264998	ENST00000509063	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.005981985	0.99401796
ENST00000264998	ENST00000401494	TF	chr3	133486980	+	ALB	chr4	74285331	+	0.004864211	0.99513584

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TF-ALB

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TF	chr3	133478117	ALB	chr4	74283976	1589	404	SAETTEDCIAKIMMQIYAHFLRRRDK
TF	chr3	133478117	ALB	chr4	74283976	979	288	SAETTEDCIAKIMMQIYAHFLRRRDK
TF	chr3	133486980	ALB	chr4	74285331	1389	425	CRFGYYGYTGAFSKETCFAEEGKKLV
TF	chr3	133486980	ALB	chr4	74285331	1999	541	CRFGYYGYTGAFSKETCFAEEGKKLV

Top

Potential FusionNeoAntigen Information of TF-ALB in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TF-ALB_133478117_74283976.msa
TF-ALB_133486980_74285331.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B52:01	IAKIMMQI	0.9992	0.8592	8	16
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:01	IMMQIYAHF	0.9956	0.9021	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:25	IMMQIYAHF	0.9918	0.9506	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-A02:04	MMQIYAHFL	0.9408	0.7316	12	21
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-A32:13	IMMQIYAHF	0.9288	0.9267	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:07	IMMQIYAHF	0.9954	0.7112	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:07	IAKIMMQIY	0.987	0.7586	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:04	IMMQIYAHF	0.9803	0.918	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:05	IMMQIYAHF	0.9408	0.9256	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C12:12	IAKIMMQIY	0.5587	0.9369	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C12:04	IAKIMMQIY	0.4581	0.997	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:135	IMMQIYAHF	0.9961	0.926	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:27	IMMQIYAHF	0.996	0.8985	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:35	IMMQIYAHF	0.9957	0.8189	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:125	IMMQIYAHF	0.9956	0.9021	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:33	IMMQIYAHF	0.9956	0.9021	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:34	IMMQIYAHF	0.9956	0.9021	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:50	IMMQIYAHF	0.9944	0.9747	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B35:11	IAKIMMQIY	0.9941	0.9029	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:24	IMMQIYAHF	0.9941	0.8009	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:39	IMMQIYAHF	0.9919	0.8299	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:11	IAKIMMQIY	0.9917	0.9231	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:08	IAKIMMQIY	0.991	0.9107	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B35:43	IAKIMMQIY	0.9893	0.9121	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:12	IMMQIYAHF	0.9891	0.932	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:13	IMMQIYAHF	0.9804	0.6483	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:35	IAKIMMQIY	0.9776	0.93	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-A32:01	IMMQIYAHF	0.9699	0.9804	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C03:02	IAKIMMQIY	0.9695	0.9726	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B35:30	IAKIMMQIY	0.9653	0.697	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B35:17	IAKIMMQIY	0.9653	0.697	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-B15:20	IMMQIYAHF	0.9417	0.9458	11	20
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C12:02	IAKIMMQIY	0.7809	0.984	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C16:04	IAKIMMQIY	0.6458	0.9842	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C12:03	IAKIMMQIY	0.6029	0.9879	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C16:01	IAKIMMQIY	0.3663	0.9777	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C02:02	IAKIMMQIY	0.1313	0.9857	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-C02:10	IAKIMMQIY	0.1313	0.9857	8	17
TF-ALB	chr3	133478117	chr4	74283976	979	HLA-A32:01	KIMMQIYAHF	0.9963	0.9684	10	20
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-B46:01	GAFSKETCF	0.8825	0.5681	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C12:12	GAFSKETCF	0.7271	0.9533	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C03:14	GAFSKETCF	0.5789	0.988	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C03:02	GAFSKETCF	0.9617	0.9771	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-B35:28	GAFSKETCF	0.9468	0.9231	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C16:04	GAFSKETCF	0.796	0.9871	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C12:02	GAFSKETCF	0.7766	0.9783	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C16:01	GAFSKETCF	0.5725	0.9872	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C02:10	GAFSKETCF	0.3887	0.9858	9	18
TF-ALB	chr3	133486980	chr4	74285331	1389	HLA-C02:02	GAFSKETCF	0.3887	0.9858	9	18

Top

Potential FusionNeoAntigen Information of TF-ALB in HLA II

TF-ALB_133478117_74283976.msa
TF-ALB_133486980_74285331.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TF-ALB	chr3	133478117	chr4	74283976	979	DRB1-1317	KIMMQIYAHFLRRRD	10	25
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1502	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1502	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1508	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1508	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1511	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1511	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1514	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1514	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1515	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1515	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1519	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1519	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1526	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1526	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1530	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1530	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1531	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1531	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1538	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1538	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1539	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1539	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1544	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1544	CRFGYYGYTGAFSKE	0	15
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1547	RFGYYGYTGAFSKET	1	16
TF-ALB	chr3	133486980	chr4	74285331	1389	DRB1-1547	CRFGYYGYTGAFSKE	0	15

Top

Fusion breakpoint peptide structures of TF-ALB

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1006	DCIAKIMMQIYAHF	TF	ALB	chr3	133478117	chr4	74283976	979

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3260	GYTGAFSKETCFAE	TF	ALB	chr3	133486980	chr4	74285331	1389

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TF-ALB

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1006	DCIAKIMMQIYAHF	-7.9962	-8.1096
HLA-B14:02	3BVN	1006	DCIAKIMMQIYAHF	-5.70842	-6.74372
HLA-B52:01	3W39	1006	DCIAKIMMQIYAHF	-6.83737	-6.95077
HLA-B52:01	3W39	1006	DCIAKIMMQIYAHF	-4.4836	-5.5189
HLA-A11:01	4UQ2	1006	DCIAKIMMQIYAHF	-10.0067	-10.1201
HLA-A11:01	4UQ2	1006	DCIAKIMMQIYAHF	-9.03915	-10.0745
HLA-A24:02	5HGA	1006	DCIAKIMMQIYAHF	-6.56204	-6.67544
HLA-A24:02	5HGA	1006	DCIAKIMMQIYAHF	-5.42271	-6.45801
HLA-B44:05	3DX8	1006	DCIAKIMMQIYAHF	-7.85648	-8.89178
HLA-B44:05	3DX8	1006	DCIAKIMMQIYAHF	-5.3978	-5.5112
HLA-B35:01	1A1N	1006	DCIAKIMMQIYAHF	-6.27422	-6.38762
HLA-B35:01	1A1N	1006	DCIAKIMMQIYAHF	-5.27424	-6.30954
HLA-A02:01	6TDR	1006	DCIAKIMMQIYAHF	-3.37154	-4.40684
HLA-B14:02	3BVN	3260	GYTGAFSKETCFAE	-7.9962	-8.1096
HLA-B14:02	3BVN	3260	GYTGAFSKETCFAE	-5.70842	-6.74372
HLA-B52:01	3W39	3260	GYTGAFSKETCFAE	-6.83737	-6.95077
HLA-B52:01	3W39	3260	GYTGAFSKETCFAE	-4.4836	-5.5189
HLA-A11:01	4UQ2	3260	GYTGAFSKETCFAE	-10.0067	-10.1201
HLA-A11:01	4UQ2	3260	GYTGAFSKETCFAE	-9.03915	-10.0745
HLA-A24:02	5HGA	3260	GYTGAFSKETCFAE	-6.56204	-6.67544
HLA-A24:02	5HGA	3260	GYTGAFSKETCFAE	-5.42271	-6.45801
HLA-B44:05	3DX8	3260	GYTGAFSKETCFAE	-7.85648	-8.89178
HLA-B44:05	3DX8	3260	GYTGAFSKETCFAE	-5.3978	-5.5112
HLA-A02:01	6TDR	3260	GYTGAFSKETCFAE	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TF-ALB

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TF-ALB	chr3	133478117	chr4	74283976	10	20	KIMMQIYAHF	AAGATCATGATGCAGATATATGCACACTTT
TF-ALB	chr3	133478117	chr4	74283976	11	20	IMMQIYAHF	ATCATGATGCAGATATATGCACACTTT
TF-ALB	chr3	133478117	chr4	74283976	12	21	MMQIYAHFL	ATGATGCAGATATATGCACACTTTCTG
TF-ALB	chr3	133478117	chr4	74283976	8	16	IAKIMMQI	ATCGCCAAGATCATGATGCAGATA
TF-ALB	chr3	133478117	chr4	74283976	8	17	IAKIMMQIY	ATCGCCAAGATCATGATGCAGATATAT
TF-ALB	chr3	133486980	chr4	74285331	9	18	GAFSKETCF	AGGCGCTTTCAGTAAGGAGACCTGCTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TF-ALB	chr3	133478117	chr4	74283976	10	25	KIMMQIYAHFLRRRD	AAGATCATGATGCAGATATATGCACACTTTCTGAGAAGGAGAGAC
TF-ALB	chr3	133486980	chr4	74285331	0	15	CRFGYYGYTGAFSKE	CTGCAGATTTGGATACTACGGCTACACAGGCGCTTTCAGTAAGGA
TF-ALB	chr3	133486980	chr4	74285331	1	16	RFGYYGYTGAFSKET	CAGATTTGGATACTACGGCTACACAGGCGCTTTCAGTAAGGAGAC

Top

Information of the samples that have these potential fusion neoantigens of TF-ALB

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
CHOL	TF-ALB	chr3	133478117	ENST00000264998	chr4	74283976	ENST00000295897	TCGA-W5-AA30-11A
CHOL	TF-ALB	chr3	133486980	ENST00000264998	chr4	74285331	ENST00000295897	TCGA-W5-AA30-11A

Top

Potential target of CAR-T therapy development for TF-ALB

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TF-ALB

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TF-ALB

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)