|
Fusion Protein:TGFB1-ERF |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: TGFB1-ERF | FusionPDB ID: 90426 | FusionGDB2.0 ID: 90426 | Hgene | Tgene | Gene symbol | TGFB1 | ERF | Gene ID | 7040 | 2107 |
Gene name | transforming growth factor beta 1 | eukaryotic translation termination factor 1 | |
Synonyms | CED|DPD1|IBDIMDE|LAP|TGF-beta1|TGFB|TGFbeta | D5S1995|ERF|ERF1|RF1|SUP45L1|TB3-1 | |
Cytomap | 19q13.2 | 5q31.2 | |
Type of gene | protein-coding | protein-coding | |
Description | transforming growth factor beta-1 proproteinTGF-beta-1latency-associated peptideprepro-transforming growth factor beta-1transforming growth factor beta1 | eukaryotic peptide chain release factor subunit 1polypeptide chain release factor 1protein Cl1sup45 (yeast omnipotent suppressor 45) homolog-like 1 | |
Modification date | 20200329 | 20200329 | |
UniProtAcc | TIAF1 Main function of 5'-partner protein: 115 | Q4G0M1 Main function of 5'-partner protein: FUNCTION: Iron-regulatory hormone that acts as an erythroid regulator after hemorrhage: produced by erythroblasts following blood loss and mediates suppression of hepcidin (HAMP) expression in the liver, thereby promoting increased iron absorption and mobilization from stores. Promotes lipid uptake into adipocytes and hepatocytes via transcriptional up-regulation of genes involved in fatty acid uptake. {ECO:0000250|UniProtKB:Q6PGN1}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000221930, | ENST00000440177, ENST00000595941, ENST00000222329, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 7 X 6=294 | 4 X 3 X 3=36 |
# samples | 9 | 4 | |
** MAII score | log2(9/294*10)=-1.70781924850669 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: TGFB1 [Title/Abstract] AND ERF [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TGFB1 [Title/Abstract] AND ERF [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TGFB1(41850651)-ERF(42754717), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | TGFB1-ERF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TGFB1-ERF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TGFB1-ERF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TGFB1-ERF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TGFB1 | GO:0001837 | epithelial to mesenchymal transition | 25893292|29529050 |
Hgene | TGFB1 | GO:0001933 | negative regulation of protein phosphorylation | 8053900 |
Hgene | TGFB1 | GO:0001934 | positive regulation of protein phosphorylation | 18625725 |
Hgene | TGFB1 | GO:0002062 | chondrocyte differentiation | 15040835 |
Hgene | TGFB1 | GO:0002244 | hematopoietic progenitor cell differentiation | 15451575 |
Hgene | TGFB1 | GO:0006611 | protein export from nucleus | 9770491|17438144|18588859 |
Hgene | TGFB1 | GO:0006754 | ATP biosynthetic process | 10513816 |
Hgene | TGFB1 | GO:0006796 | phosphate-containing compound metabolic process | 10513816 |
Hgene | TGFB1 | GO:0006954 | inflammatory response | 21147091 |
Hgene | TGFB1 | GO:0007050 | cell cycle arrest | 14555988 |
Hgene | TGFB1 | GO:0007093 | mitotic cell cycle checkpoint | 15334054 |
Hgene | TGFB1 | GO:0007173 | epidermal growth factor receptor signaling pathway | 18625725 |
Hgene | TGFB1 | GO:0007179 | transforming growth factor beta receptor signaling pathway | 9389648|11157754 |
Hgene | TGFB1 | GO:0007182 | common-partner SMAD protein phosphorylation | 20573232 |
Hgene | TGFB1 | GO:0007183 | SMAD protein complex assembly | 17438144 |
Hgene | TGFB1 | GO:0008284 | positive regulation of cell proliferation | 10513816|14633705 |
Hgene | TGFB1 | GO:0008285 | negative regulation of cell proliferation | 15334054 |
Hgene | TGFB1 | GO:0010628 | positive regulation of gene expression | 18625725|18832382|18941241|19913496|25322725|26634652|26687115|27162619|29167509 |
Hgene | TGFB1 | GO:0010629 | negative regulation of gene expression | 19913496|20067797|22269326|25163461|26634652|29167509|29529050 |
Hgene | TGFB1 | GO:0010718 | positive regulation of epithelial to mesenchymal transition | 17999987|18505915 |
Hgene | TGFB1 | GO:0010763 | positive regulation of fibroblast migration | 18555217 |
Hgene | TGFB1 | GO:0010800 | positive regulation of peptidyl-threonine phosphorylation | 18625725|19736306 |
Hgene | TGFB1 | GO:0010862 | positive regulation of pathway-restricted SMAD protein phosphorylation | 9389648|19736306|26634652 |
Hgene | TGFB1 | GO:0010936 | negative regulation of macrophage cytokine production | 20875417 |
Hgene | TGFB1 | GO:0016477 | cell migration | 25893292 |
Hgene | TGFB1 | GO:0017015 | regulation of transforming growth factor beta receptor signaling pathway | 15334054 |
Hgene | TGFB1 | GO:0022408 | negative regulation of cell-cell adhesion | 18593713 |
Hgene | TGFB1 | GO:0030214 | hyaluronan catabolic process | 17324121 |
Hgene | TGFB1 | GO:0030308 | negative regulation of cell growth | 15334054 |
Hgene | TGFB1 | GO:0030335 | positive regulation of cell migration | 19736306 |
Hgene | TGFB1 | GO:0031293 | membrane protein intracellular domain proteolysis | 25310401 |
Hgene | TGFB1 | GO:0031334 | positive regulation of protein complex assembly | 19366691 |
Hgene | TGFB1 | GO:0031663 | lipopolysaccharide-mediated signaling pathway | 21147091 |
Hgene | TGFB1 | GO:0032270 | positive regulation of cellular protein metabolic process | 15219857 |
Hgene | TGFB1 | GO:0032355 | response to estradiol | 18039789 |
Hgene | TGFB1 | GO:0032570 | response to progesterone | 18039789 |
Hgene | TGFB1 | GO:0032740 | positive regulation of interleukin-17 production | 18453574 |
Hgene | TGFB1 | GO:0032801 | receptor catabolic process | 17878231 |
Hgene | TGFB1 | GO:0032930 | positive regulation of superoxide anion generation | 22073128 |
Hgene | TGFB1 | GO:0032967 | positive regulation of collagen biosynthetic process | 19734317|22269326|25310401 |
Hgene | TGFB1 | GO:0033138 | positive regulation of peptidyl-serine phosphorylation | 18625725|19736306 |
Hgene | TGFB1 | GO:0035307 | positive regulation of protein dephosphorylation | 14555988 |
Hgene | TGFB1 | GO:0042307 | positive regulation of protein import into nucleus | 19366691 |
Hgene | TGFB1 | GO:0043117 | positive regulation of vascular permeability | 21168935 |
Hgene | TGFB1 | GO:0043406 | positive regulation of MAP kinase activity | 18625725 |
Hgene | TGFB1 | GO:0043536 | positive regulation of blood vessel endothelial cell migration | 18555217 |
Hgene | TGFB1 | GO:0043537 | negative regulation of blood vessel endothelial cell migration | 18555217 |
Hgene | TGFB1 | GO:0043552 | positive regulation of phosphatidylinositol 3-kinase activity | 18625725 |
Hgene | TGFB1 | GO:0045216 | cell-cell junction organization | 18505915 |
Hgene | TGFB1 | GO:0045599 | negative regulation of fat cell differentiation | 15040835 |
Hgene | TGFB1 | GO:0045662 | negative regulation of myoblast differentiation | 9770491 |
Hgene | TGFB1 | GO:0045786 | negative regulation of cell cycle | 11502704 |
Hgene | TGFB1 | GO:0045892 | negative regulation of transcription, DNA-templated | 15702480|18832382 |
Hgene | TGFB1 | GO:0045893 | positive regulation of transcription, DNA-templated | 9389648|14517293|15334054|16816361 |
Hgene | TGFB1 | GO:0045918 | negative regulation of cytolysis | 24586048 |
Hgene | TGFB1 | GO:0045930 | negative regulation of mitotic cell cycle | 14555988 |
Hgene | TGFB1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 18832382 |
Hgene | TGFB1 | GO:0048298 | positive regulation of isotype switching to IgA isotypes | 14988498 |
Hgene | TGFB1 | GO:0048642 | negative regulation of skeletal muscle tissue development | 9770491 |
Hgene | TGFB1 | GO:0050680 | negative regulation of epithelial cell proliferation | 9950587 |
Hgene | TGFB1 | GO:0050714 | positive regulation of protein secretion | 18505915 |
Hgene | TGFB1 | GO:0050731 | positive regulation of peptidyl-tyrosine phosphorylation | 21168935 |
Hgene | TGFB1 | GO:0050921 | positive regulation of chemotaxis | 18555217 |
Hgene | TGFB1 | GO:0051897 | positive regulation of protein kinase B signaling | 18625725 |
Hgene | TGFB1 | GO:0060389 | pathway-restricted SMAD protein phosphorylation | 11157754|17999987|18453574|25893292 |
Hgene | TGFB1 | GO:0060390 | regulation of SMAD protein signal transduction | 25893292 |
Hgene | TGFB1 | GO:0060391 | positive regulation of SMAD protein signal transduction | 9389648|19366691|29167509 |
Hgene | TGFB1 | GO:0070168 | negative regulation of biomineral tissue development | 26634652 |
Hgene | TGFB1 | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 25310401 |
Hgene | TGFB1 | GO:0070723 | response to cholesterol | 17878231 |
Hgene | TGFB1 | GO:0071407 | cellular response to organic cyclic compound | 21147091 |
Hgene | TGFB1 | GO:0071560 | cellular response to transforming growth factor beta stimulus | 19736306|22269326 |
Hgene | TGFB1 | GO:0085029 | extracellular matrix assembly | 19734317 |
Hgene | TGFB1 | GO:0090263 | positive regulation of canonical Wnt signaling pathway | 12893825|15040835 |
Hgene | TGFB1 | GO:0097191 | extrinsic apoptotic signaling pathway | 15334054 |
Hgene | TGFB1 | GO:1900126 | negative regulation of hyaluronan biosynthetic process | 17324121 |
Hgene | TGFB1 | GO:1900182 | positive regulation of protein localization to nucleus | 26634652 |
Hgene | TGFB1 | GO:1901666 | positive regulation of NAD+ ADP-ribosyltransferase activity | 22073128 |
Hgene | TGFB1 | GO:1902895 | positive regulation of pri-miRNA transcription by RNA polymerase II | 26311719|26493107 |
Hgene | TGFB1 | GO:1903077 | negative regulation of protein localization to plasma membrane | 21168935|24586048 |
Hgene | TGFB1 | GO:1903800 | positive regulation of production of miRNAs involved in gene silencing by miRNA | 18548003 |
Hgene | TGFB1 | GO:2000679 | positive regulation of transcription regulatory region DNA binding | 22073128 |
Hgene | TGFB1 | GO:2000727 | positive regulation of cardiac muscle cell differentiation | 25163461 |
Tgene | ERF | GO:0006415 | translational termination | 7990965 |
Tgene | ERF | GO:0006479 | protein methylation | 18539146 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:41850651/chr19:42754717) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across TGFB1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across ERF (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000221930 | TGFB1 | chr19 | 41850651 | - | ENST00000222329 | ERF | chr19 | 42754717 | - | 4019 | 1501 | 171 | 3125 | 984 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000221930 | ENST00000222329 | TGFB1 | chr19 | 41850651 | - | ERF | chr19 | 42754717 | - | 0.004881777 | 0.99511826 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TGFB1-ERF |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TGFB1 | chr19 | 41850651 | ERF | chr19 | 42754717 | 1501 | 443 | DVTGVVRQWLSRGGFAFPDWAYKPES |
Top |
Potential FusionNeoAntigen Information of TGFB1-ERF in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
TGFB1-ERF_41850651_42754717.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:01 | RQWLSRGGF | 0.992 | 0.9161 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:25 | WLSRGGFAF | 0.9473 | 0.9591 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:02 | WLSRGGFAF | 0.946 | 0.967 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B48:01 | RQWLSRGGF | 0.7485 | 0.6803 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:25 | RQWLSRGGF | 0.717 | 0.957 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:03 | RQWLSRGGF | 0.5352 | 0.8492 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B13:01 | RQWLSRGGF | 0.4705 | 0.9541 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B27:02 | SRGGFAFPDW | 0.9988 | 0.5076 | 10 | 20 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-A29:10 | GGFAFPDWAY | 0.9901 | 0.5733 | 12 | 22 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B57:01 | LSRGGFAFPDW | 0.9999 | 0.9919 | 9 | 20 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:03 | RQWLSRGGFAF | 0.9785 | 0.8793 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B13:01 | RQWLSRGGFAF | 0.9715 | 0.9863 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:07 | RQWLSRGGF | 0.9654 | 0.6959 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:21 | WLSRGGFAF | 0.9469 | 0.9275 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:04 | RQWLSRGGF | 0.9259 | 0.9519 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:31 | WLSRGGFAF | 0.846 | 0.9533 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:05 | WLSRGGFAF | 0.827 | 0.9481 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:05 | RQWLSRGGF | 0.2977 | 0.9221 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-A29:01 | GGFAFPDWAY | 0.9901 | 0.5733 | 12 | 22 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-A29:02 | GGFAFPDWAY | 0.9901 | 0.5733 | 12 | 22 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:07 | RQWLSRGGFAF | 0.9965 | 0.7211 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:05 | RQWLSRGGFAF | 0.9619 | 0.9063 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:33 | RQWLSRGGF | 0.992 | 0.9161 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:125 | RQWLSRGGF | 0.992 | 0.9161 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:34 | RQWLSRGGF | 0.992 | 0.9161 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:135 | RQWLSRGGF | 0.9919 | 0.9282 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:27 | RQWLSRGGF | 0.9916 | 0.9168 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:50 | RQWLSRGGF | 0.9879 | 0.9339 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:24 | RQWLSRGGF | 0.9845 | 0.9467 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:39 | WLSRGGFAF | 0.9468 | 0.9128 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:35 | RQWLSRGGF | 0.9358 | 0.8539 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:12 | RQWLSRGGF | 0.9294 | 0.7914 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:53 | RQWLSRGGF | 0.855 | 0.8861 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:20 | WLSRGGFAF | 0.8424 | 0.9718 | 8 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:54 | RQWLSRGGF | 0.7558 | 0.8786 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:39 | RQWLSRGGF | 0.7435 | 0.8895 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:68 | RQWLSRGGF | 0.6908 | 0.6287 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:20 | RQWLSRGGF | 0.2886 | 0.9522 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B35:28 | RQWLSRGGF | 0.2784 | 0.9555 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B48:02 | RQWLSRGGF | 0.2369 | 0.9441 | 6 | 15 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B57:10 | LSRGGFAFPDW | 0.9999 | 0.9919 | 9 | 20 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:68 | RQWLSRGGFAF | 0.9961 | 0.6541 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:35 | RQWLSRGGFAF | 0.9958 | 0.8924 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-A32:01 | RQWLSRGGFAF | 0.9945 | 0.9592 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:54 | RQWLSRGGFAF | 0.9846 | 0.8837 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B15:20 | RQWLSRGGFAF | 0.9616 | 0.9433 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B35:28 | RQWLSRGGFAF | 0.9609 | 0.9489 | 6 | 17 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | HLA-B48:02 | RQWLSRGGFAF | 0.9608 | 0.9371 | 6 | 17 |
Top |
Potential FusionNeoAntigen Information of TGFB1-ERF in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
TGFB1-ERF_41850651_42754717.msa |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | DRB1-0437 | VTGVVRQWLSRGGFA | 1 | 16 |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 | DRB1-0437 | TGVVRQWLSRGGFAF | 2 | 17 |
Top |
Fusion breakpoint peptide structures of TGFB1-ERF |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8144 | RQWLSRGGFAFPDW | TGFB1 | ERF | chr19 | 41850651 | chr19 | 42754717 | 1501 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TGFB1-ERF |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8144 | RQWLSRGGFAFPDW | -6.60553 | -6.71893 |
HLA-B14:02 | 3BVN | 8144 | RQWLSRGGFAFPDW | -3.25382 | -4.28912 |
HLA-B52:01 | 3W39 | 8144 | RQWLSRGGFAFPDW | -5.90011 | -6.01351 |
HLA-B52:01 | 3W39 | 8144 | RQWLSRGGFAFPDW | -5.4415 | -6.4768 |
HLA-B18:01 | 4JQV | 8144 | RQWLSRGGFAFPDW | -2.23313 | -2.34653 |
HLA-A11:01 | 4UQ2 | 8144 | RQWLSRGGFAFPDW | -6.31705 | -6.43045 |
HLA-A11:01 | 4UQ2 | 8144 | RQWLSRGGFAFPDW | -4.25402 | -5.28932 |
HLA-A24:02 | 5HGA | 8144 | RQWLSRGGFAFPDW | -7.95591 | -8.06931 |
HLA-A24:02 | 5HGA | 8144 | RQWLSRGGFAFPDW | -6.24522 | -7.28052 |
HLA-B27:05 | 6PYJ | 8144 | RQWLSRGGFAFPDW | -3.83335 | -4.86865 |
HLA-B44:05 | 3DX8 | 8144 | RQWLSRGGFAFPDW | -6.2025 | -6.3159 |
HLA-B44:05 | 3DX8 | 8144 | RQWLSRGGFAFPDW | -5.27651 | -6.31181 |
HLA-A02:01 | 6TDR | 8144 | RQWLSRGGFAFPDW | -6.48102 | -6.59442 |
Top |
Vaccine Design for the FusionNeoAntigens of TGFB1-ERF |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 10 | 20 | SRGGFAFPDW | GCCGTGGAGGGTTTGCCTTCCCGGATTGGG |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 12 | 22 | GGFAFPDWAY | GAGGGTTTGCCTTCCCGGATTGGGCCTACA |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 6 | 15 | RQWLSRGGF | GGCAGTGGTTGAGCCGTGGAGGGTTTG |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 6 | 17 | RQWLSRGGFAF | GGCAGTGGTTGAGCCGTGGAGGGTTTGCCTTCC |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 8 | 17 | WLSRGGFAF | GGTTGAGCCGTGGAGGGTTTGCCTTCC |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 9 | 20 | LSRGGFAFPDW | TGAGCCGTGGAGGGTTTGCCTTCCCGGATTGGG |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 1 | 16 | VTGVVRQWLSRGGFA | TCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGTTTGCCT |
TGFB1-ERF | chr19 | 41850651 | chr19 | 42754717 | 2 | 17 | TGVVRQWLSRGGFAF | CCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGTTTGCCTTCC |
Top |
Information of the samples that have these potential fusion neoantigens of TGFB1-ERF |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | TGFB1-ERF | chr19 | 41850651 | ENST00000221930 | chr19 | 42754717 | ENST00000222329 | TCGA-VQ-A922 |
Top |
Potential target of CAR-T therapy development for TGFB1-ERF |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TGFB1-ERF |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TGFB1-ERF |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |