Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TNFSF12-PI4KA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TNFSF12-PI4KA
	FusionPDB ID: 92673
	FusionGDB2.0 ID: 92673
		Hgene	Tgene
	Gene symbol	TNFSF12	PI4KA
	Gene ID	8742	5297
	Gene name	TNF superfamily member 12	phosphatidylinositol 4-kinase alpha
	Synonyms	APO3L\|DR3LG\|TNLG4A\|TWEAK	PI4K-ALPHA\|PIK4CA\|PMGYCHA\|pi4K230
	Cytomap	17p13.1	22q11.21
	Type of gene	protein-coding	protein-coding
	Description	tumor necrosis factor ligand superfamily member 12APO3 ligandAPO3/DR3 ligandTNF-related WEAK inducer of apoptosistumor necrosis factor (ligand) superfamily, member 12tumor necrosis factor ligand 4Atumor necrosis factor superfamily member 12	phosphatidylinositol 4-kinase alphaPI4-kinase alphaphosphatidylinositol 4-kinase 230phosphatidylinositol 4-kinase III alphaphosphatidylinositol 4-kinase IIII+/-phosphatidylinositol 4-kinase, catalytic, alphaphosphatidylinositol 4-kinase, type III, a
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000462811, ENST00000293825, ENST00000557233,	ENST00000255882, ENST00000414196, ENST00000572273, ENST00000466162,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 2=8	11 X 11 X 5=605
	# samples	2	11
	** MAII score	log2(2/8*10)=1.32192809488736	log2(11/605*10)=-2.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TNFSF12 [Title/Abstract] AND PI4KA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TNFSF12 [Title/Abstract] AND PI4KA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TNFSF12(7454295)-PI4KA(21068988), # samples:1
Anticipated loss of major functional domain due to fusion event.	TNFSF12-PI4KA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TNFSF12-PI4KA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TNFSF12-PI4KA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TNFSF12-PI4KA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TNFSF12	GO:0045732	positive regulation of protein catabolic process	17389268
Hgene	TNFSF12	GO:2001238	positive regulation of extrinsic apoptotic signaling pathway	21525013
Tgene	PI4KA	GO:0016310	phosphorylation	25327288

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:7454295/chr22:21068988)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TNFSF12 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PI4KA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000293825	TNFSF12	chr17	7454295	+	ENST00000255882	PI4KA	chr22	21068988	-	1984	636	26	1627	533
ENST00000293825	TNFSF12	chr17	7454295	+	ENST00000572273	PI4KA	chr22	21068988	-	1982	636	26	1627	533
ENST00000293825	TNFSF12	chr17	7454295	+	ENST00000414196	PI4KA	chr22	21068988	-	1982	636	26	1627	533
ENST00000557233	TNFSF12	chr17	7454295	+	ENST00000255882	PI4KA	chr22	21068988	-	1721	373	0	1364	454
ENST00000557233	TNFSF12	chr17	7454295	+	ENST00000572273	PI4KA	chr22	21068988	-	1719	373	0	1364	454
ENST00000557233	TNFSF12	chr17	7454295	+	ENST00000414196	PI4KA	chr22	21068988	-	1719	373	0	1364	454

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000293825	ENST00000255882	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.005960781	0.9940393
ENST00000293825	ENST00000572273	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.005993102	0.9940069
ENST00000293825	ENST00000414196	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.005993102	0.9940069
ENST00000557233	ENST00000255882	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.004744398	0.99525553
ENST00000557233	ENST00000572273	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.004784755	0.9952153
ENST00000557233	ENST00000414196	TNFSF12	chr17	7454295	+	PI4KA	chr22	21068988	-	0.004784755	0.9952153

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TNFSF12-PI4KA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TNFSF12	chr17	7454295	PI4KA	chr22	21068988	373	20	RRRGRRGEPGTALLVPLALGLGLALA
TNFSF12	chr17	7454295	PI4KA	chr22	21068988	636	99	RRRGRRGEPGTALLVPLALGLGLALA

Top

Potential FusionNeoAntigen Information of TNFSF12-PI4KA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TNFSF12-PI4KA_7454295_21068988.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B14:02	TALLVPLAL	0.9899	0.9744	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B14:01	TALLVPLAL	0.9899	0.9744	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:22	LLVPLALGL	0.9849	0.617	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:02	TALLVPLAL	0.9837	0.9167	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:03	TALLVPLAL	0.9788	0.9162	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:11	LLVPLALGL	0.9706	0.6013	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:30	LLVPLALGL	0.9685	0.5506	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:24	LLVPLALGL	0.9685	0.5506	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:67	LLVPLALGL	0.9685	0.5506	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:60	LLVPLALGL	0.9677	0.6161	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B52:01	TALLVPLAL	0.9612	0.9959	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:02	TALLVPLAL	0.9525	0.9778	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:04	TALLVPLAL	0.9525	0.9778	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:16	LLVPLALGL	0.9491	0.5474	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:01	TALLVPLAL	0.9466	0.9352	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:35	LLVPLALGL	0.9405	0.5676	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:05	TALLVPLAL	0.938	0.7305	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:04	LLVPLALGL	0.9345	0.9409	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:17	LLVPLALGL	0.9299	0.9588	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:29	LLVPLALGL	0.9122	0.5551	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:20	LLVPLALGL	0.8942	0.5565	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B81:01	TALLVPLAL	0.8647	0.765	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:19	LLVPLALGL	0.8583	0.6886	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B08:01	TALLVPLAL	0.7691	0.8251	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:05	RRGEPGTALL	0.9993	0.7131	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:04	RRGEPGTALL	0.9993	0.7073	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:02	RRGEPGTALL	0.9993	0.5027	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:07	RRGEPGTALL	0.9991	0.7046	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B07:10	RRGEPGTALL	0.8865	0.5836	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:07	GRRGEPGTALL	0.9999	0.7047	3	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C05:09	RGEPGTALL	0.9997	0.9737	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:15	RGEPGTALL	0.9996	0.9804	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:08	TALLVPLAL	0.9995	0.8962	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:07	TALLVPLAL	0.9995	0.9867	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:19	TALLVPLAL	0.9995	0.9931	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C15:06	TALLVPLAL	0.9991	0.9576	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C04:06	TALLVPLAL	0.9973	0.9884	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:04	TALLVPLAL	0.9922	0.9967	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:13	TALLVPLAL	0.9922	0.9967	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:02	LLVPLALGL	0.9855	0.6314	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:01	LLVPLALGL	0.9685	0.5506	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-A02:07	LLVPLALGL	0.9678	0.6009	12	21
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:14	TALLVPLAL	0.9677	0.9813	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B56:04	TALLVPLAL	0.9672	0.6268	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C12:12	TALLVPLAL	0.9647	0.9673	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C06:03	TALLVPLAL	0.9603	0.9957	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C12:04	TALLVPLAL	0.9561	0.9958	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:07	TALLVPLAL	0.9531	0.9939	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:12	TALLVPLAL	0.9525	0.9778	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B78:01	TALLVPLAL	0.9386	0.9825	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:03	TALLVPLAL	0.9343	0.9969	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C02:06	TALLVPLAL	0.8791	0.9918	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:04	RGEPGTALL	0.8394	0.9837	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:13	RGEPGTALL	0.8394	0.9837	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:08	TALLVPLAL	0.8262	0.6781	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B39:10	TALLVPLAL	0.8125	0.9777	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:03	RGEPGTALL	0.5563	0.9914	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:14	RRGEPGTALL	0.9994	0.6945	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C07:95	RRGEPGTALL	0.9965	0.7381	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:03	RRGEPGTALL	0.9828	0.7365	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:13	EPGTALLV	0.991	0.581	7	15
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:09	EPGTALLV	0.9875	0.6039	7	15
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:21	EPGTALLV	0.9657	0.6432	7	15
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C04:03	RGEPGTALL	0.9997	0.9552	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C05:01	RGEPGTALL	0.9997	0.9737	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:03	TALLVPLAL	0.9996	0.9878	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:04	TALLVPLAL	0.9996	0.9878	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:02	RGEPGTALL	0.9996	0.9804	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:67	TALLVPLAL	0.9994	0.9826	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:05	TALLVPLAL	0.9993	0.9259	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:17	TALLVPLAL	0.9991	0.976	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:02	TALLVPLAL	0.999	0.9843	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C15:05	TALLVPLAL	0.9988	0.9822	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C15:02	TALLVPLAL	0.9987	0.961	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C16:04	TALLVPLAL	0.9928	0.9866	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:13	TALLVPLAL	0.9725	0.9213	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C12:03	TALLVPLAL	0.9697	0.9879	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B56:02	TALLVPLAL	0.9672	0.6268	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:22	TALLVPLAL	0.9649	0.6632	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C12:02	TALLVPLAL	0.9641	0.9816	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C16:01	TALLVPLAL	0.9602	0.9874	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:06	TALLVPLAL	0.9526	0.9229	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:09	TALLVPLAL	0.9525	0.9778	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B78:02	TALLVPLAL	0.95	0.9856	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:13	TALLVPLAL	0.9451	0.841	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:14	TALLVPLAL	0.9445	0.8636	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:17	TALLVPLAL	0.943	0.8498	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B35:30	TALLVPLAL	0.943	0.8498	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C03:06	TALLVPLAL	0.9381	0.9893	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C16:02	TALLVPLAL	0.9356	0.9951	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:01	TALLVPLAL	0.9343	0.9969	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:21	TALLVPLAL	0.9088	0.9103	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B51:09	TALLVPLAL	0.9068	0.818	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B08:12	TALLVPLAL	0.8708	0.9197	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C17:01	TALLVPLAL	0.8455	0.9929	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B08:18	TALLVPLAL	0.7691	0.8251	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C08:01	RGEPGTALL	0.5563	0.9914	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B07:13	TALLVPLAL	0.5012	0.8804	10	19
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B07:13	RGEPGTALL	0.2845	0.8048	5	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:10	RRGEPGTALL	0.9994	0.8082	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:08	RRGEPGTALL	0.9993	0.6235	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:06	RRGEPGTALL	0.9993	0.7491	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:09	RRGEPGTALL	0.9991	0.7213	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C07:01	RRGEPGTALL	0.9968	0.7413	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-C07:22	RRGEPGTALL	0.9809	0.7679	4	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:06	GRRGEPGTALL	0.9999	0.7166	3	14
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	636	HLA-B27:09	GRRGEPGTALL	0.9999	0.5214	3	14

Top

Potential FusionNeoAntigen Information of TNFSF12-PI4KA in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of TNFSF12-PI4KA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2758	GEPGTALLVPLALG	TNFSF12	PI4KA	chr17	7454295	chr22	21068988	636

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TNFSF12-PI4KA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2758	GEPGTALLVPLALG	-7.9962	-8.1096
HLA-B14:02	3BVN	2758	GEPGTALLVPLALG	-5.70842	-6.74372
HLA-B52:01	3W39	2758	GEPGTALLVPLALG	-6.83737	-6.95077
HLA-B52:01	3W39	2758	GEPGTALLVPLALG	-4.4836	-5.5189
HLA-A11:01	4UQ2	2758	GEPGTALLVPLALG	-10.0067	-10.1201
HLA-A11:01	4UQ2	2758	GEPGTALLVPLALG	-9.03915	-10.0745
HLA-A24:02	5HGA	2758	GEPGTALLVPLALG	-6.56204	-6.67544
HLA-A24:02	5HGA	2758	GEPGTALLVPLALG	-5.42271	-6.45801
HLA-B44:05	3DX8	2758	GEPGTALLVPLALG	-7.85648	-8.89178
HLA-B44:05	3DX8	2758	GEPGTALLVPLALG	-5.3978	-5.5112
HLA-A02:01	6TDR	2758	GEPGTALLVPLALG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TNFSF12-PI4KA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	10	19	TALLVPLAL	CGCAGGCAGGCTGCTACCTGCCCAGCA
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	12	21	LLVPLALGL	CAGGCTGCTACCTGCCCAGCAACCCTG
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	3	14	GRRGEPGTALL	CACGACCTGGACAGGACGGAGCGCAGGCAGGCT
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	4	14	RRGEPGTALL	GACCTGGACAGGACGGAGCGCAGGCAGGCT
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	5	14	RGEPGTALL	CTGGACAGGACGGAGCGCAGGCAGGCT
TNFSF12-PI4KA	chr17	7454295	chr22	21068988	7	15	EPGTALLV	AGGACGGAGCGCAGGCAGGCTGCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of TNFSF12-PI4KA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	TNFSF12-PI4KA	chr17	7454295	ENST00000293825	chr22	21068988	ENST00000255882	2397N

Top

Potential target of CAR-T therapy development for TNFSF12-PI4KA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

TNFSF12

chr17:7454295

chr22:21068988

ENST00000293825

22_42

124

250.0

Transmembrane

Helical%3B Signal-anchor for type II membrane protein

Hgene

TNFSF12

chr17:7454295

chr22:21068988

ENST00000557233

22_42

124

331.0

Transmembrane

Helical%3B Signal-anchor for type II membrane protein

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TNFSF12-PI4KA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TNFSF12-PI4KA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)