Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BCL2L11-CCDC170

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BCL2L11-CCDC170
	FusionPDB ID: 9343
	FusionGDB2.0 ID: 9343
		Hgene	Tgene
	Gene symbol	BCL2L11	CCDC170
	Gene ID	10018	80129
	Gene name	BCL2 like 11	coiled-coil domain containing 170
	Synonyms	BAM\|BIM\|BOD	C6orf97\|bA282P11.1
	Cytomap	2q13	6q25.1
	Type of gene	protein-coding	protein-coding
	Description	bcl-2-like protein 11BCL2-like 11 (apoptosis facilitator)bcl-2 interacting mediator of cell deathbcl-2 interacting protein Bimbcl-2-related ovarian death agonist	coiled-coil domain-containing protein 170
	Modification date	20200313	20200313
	UniProtAcc	O43521 Main function of 5'-partner protein: FUNCTION: Induces apoptosis and anoikis. Isoform BimL is more potent than isoform BimEL. Isoform Bim-alpha1, isoform Bim-alpha2 and isoform Bim-alpha3 induce apoptosis, although less potent than isoform BimEL, isoform BimL and isoform BimS. Isoform Bim-gamma induces apoptosis. Isoform Bim-alpha3 induces apoptosis possibly through a caspase-mediated pathway. Isoform BimAC and isoform BimABC lack the ability to induce apoptosis. {ECO:0000269\|PubMed:11997495, ECO:0000269\|PubMed:15486195, ECO:0000269\|PubMed:9430630}.	Q8IYT3 Main function of 5'-partner protein: FUNCTION: Plays a role in Golgi-associated microtubules organization and stabilization. {ECO:0000269\|PubMed:28687497}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000308659, ENST00000357757, ENST00000393253, ENST00000393256, ENST00000337565, ENST00000405953,	ENST00000544131, ENST00000239374, ENST00000367290,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 4 X 6=168	7 X 13 X 7=637
	# samples	9	20
	** MAII score	log2(9/168*10)=-0.900464326449086 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(20/637*10)=-1.67129337248158 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BCL2L11 [Title/Abstract] AND CCDC170 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BCL2L11 [Title/Abstract] AND CCDC170 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BCL2L11(111907724)-CCDC170(151894309), # samples:2
Anticipated loss of major functional domain due to fusion event.	BCL2L11-CCDC170 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BCL2L11-CCDC170 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BCL2L11-CCDC170 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BCL2L11-CCDC170 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	BCL2L11	GO:0008630	intrinsic apoptotic signaling pathway in response to DNA damage	11546872
Hgene	BCL2L11	GO:0031334	positive regulation of protein complex assembly	21041309
Hgene	BCL2L11	GO:0034976	response to endoplasmic reticulum stress	22761832
Hgene	BCL2L11	GO:2000271	positive regulation of fibroblast apoptotic process	11997495

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:111907724/chr6:151894309)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BCL2L11 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CCDC170 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000393253	BCL2L11	chr2	111907724	+	ENST00000239374	CCDC170	chr6	151894309	+	4936	516	126	1889	587
ENST00000393253	BCL2L11	chr2	111907724	+	ENST00000367290	CCDC170	chr6	151894309	+	4957	516	126	1910	594
ENST00000357757	BCL2L11	chr2	111907724	+	ENST00000239374	CCDC170	chr6	151894309	+	5206	786	126	2159	677
ENST00000357757	BCL2L11	chr2	111907724	+	ENST00000367290	CCDC170	chr6	151894309	+	5227	786	126	2180	684
ENST00000308659	BCL2L11	chr2	111907724	+	ENST00000239374	CCDC170	chr6	151894309	+	5026	606	126	1979	617
ENST00000308659	BCL2L11	chr2	111907724	+	ENST00000367290	CCDC170	chr6	151894309	+	5047	606	126	2000	624
ENST00000393256	BCL2L11	chr2	111907724	+	ENST00000239374	CCDC170	chr6	151894309	+	5191	771	111	2144	677
ENST00000393256	BCL2L11	chr2	111907724	+	ENST00000367290	CCDC170	chr6	151894309	+	5212	771	111	2165	684

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000393253	ENST00000239374	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.000710421	0.9992895
ENST00000393253	ENST00000367290	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.000790148	0.9992099
ENST00000357757	ENST00000239374	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.001007366	0.9989926
ENST00000357757	ENST00000367290	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.001137514	0.9988625
ENST00000308659	ENST00000239374	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.001091145	0.9989089
ENST00000308659	ENST00000367290	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.00112061	0.9988794
ENST00000393256	ENST00000239374	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.001003686	0.9989963
ENST00000393256	ENST00000367290	BCL2L11	chr2	111907724	+	CCDC170	chr6	151894309	+	0.001136036	0.99886394

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BCL2L11-CCDC170

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BCL2L11	chr2	111907724	CCDC170	chr6	151894309	516	130	RIGDEFNAYYARRDLLSAVEAKEALE
BCL2L11	chr2	111907724	CCDC170	chr6	151894309	606	160	RIGDEFNAYYARRDLLSAVEAKEALE
BCL2L11	chr2	111907724	CCDC170	chr6	151894309	771	220	RIGDEFNAYYARRDLLSAVEAKEALE
BCL2L11	chr2	111907724	CCDC170	chr6	151894309	786	220	RIGDEFNAYYARRDLLSAVEAKEALE

Top

Potential FusionNeoAntigen Information of BCL2L11-CCDC170 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BCL2L11-CCDC170_111907724_151894309.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:07	ARRDLLSAV	0.9974	0.6447	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:04	ARRDLLSAV	0.9952	0.6603	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B39:06	ARRDLLSAV	0.9861	0.822	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B08:09	YARRDLLSA	0.9819	0.5774	9	18
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B07:10	ARRDLLSAV	0.0124	0.5616	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:05	RRDLLSAVEAK	0.9997	0.6505	11	22
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B40:06	RDLLSAVEA	0.9978	0.7794	12	21
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:14	ARRDLLSAV	0.9947	0.6972	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B54:01	YARRDLLSA	0.9872	0.5022	9	18
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C03:08	NAYYARRDL	0.9849	0.8167	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B73:01	ARRDLLSAV	0.9739	0.7961	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:05	ARRDLLSAV	0.9472	0.9631	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C12:12	NAYYARRDL	0.876	0.8796	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C06:03	NAYYARRDL	0.7864	0.9881	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C12:04	NAYYARRDL	0.7657	0.9898	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:19	AYYARRDLL	0.3761	0.6796	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:05	AYYARRDLL	0.3687	0.9379	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:67	AYYARRDLL	0.318	0.8705	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:80	AYYARRDLL	0.318	0.8705	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:13	AYYARRDLL	0.3003	0.8154	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:29	AYYARRDLL	0.3	0.9078	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:10	AYYARRDLL	0.2511	0.9168	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:46	AYYARRDLL	0.2105	0.7831	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C12:16	ARRDLLSAV	0.0024	0.947	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:14	RRDLLSAVEAK	0.9994	0.5889	11	22
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:03	RRDLLSAVEAK	0.9834	0.6777	11	22
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:03	YYARRDLL	0.7394	0.9084	8	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:02	YYARRDLL	0.7394	0.9084	8	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:03	AYYARRDL	0.5763	0.9239	7	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:02	AYYARRDL	0.5763	0.9239	7	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:06	ARRDLLSAV	0.9973	0.6311	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:09	ARRDLLSAV	0.9958	0.6602	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:10	ARRDLLSAV	0.9955	0.7508	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:08	ARRDLLSAV	0.9942	0.6303	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C03:04	NAYYARRDL	0.9935	0.973	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C03:03	NAYYARRDL	0.9935	0.973	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C03:05	NAYYARRDL	0.9846	0.8401	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C03:17	NAYYARRDL	0.9826	0.9256	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C16:04	NAYYARRDL	0.9625	0.9748	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C06:08	ARRDLLSAV	0.8803	0.9837	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:01	ARRDLLSAV	0.8664	0.6369	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C12:03	NAYYARRDL	0.8378	0.9646	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C16:01	NAYYARRDL	0.4699	0.9589	6	15
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:22	ARRDLLSAV	0.4154	0.7158	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:17	AYYARRDLL	0.3513	0.943	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:02	AYYARRDLL	0.318	0.8705	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B78:02	YARRDLLSA	0.3121	0.5013	9	18
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C07:04	AYYARRDLL	0.2926	0.8399	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:02	AYYARRDLL	0.1216	0.9477	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C14:03	AYYARRDLL	0.1216	0.9477	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C06:06	AYYARRDLL	0.0511	0.9868	7	16
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C06:17	ARRDLLSAV	0.0395	0.9876	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-C06:02	ARRDLLSAV	0.0395	0.9876	10	19
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	HLA-B27:10	RRDLLSAVEAK	0.9996	0.6925	11	22

Top

Potential FusionNeoAntigen Information of BCL2L11-CCDC170 in HLA II

BCL2L11-CCDC170_111907724_151894309.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	DRB1-0908	RRDLLSAVEAKEALE	11	26
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	DRB1-1515	GDEFNAYYARRDLLS	2	17
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	DRB1-1529	GDEFNAYYARRDLLS	2	17
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	606	DRB1-1530	GDEFNAYYARRDLLS	2	17

Top

Fusion breakpoint peptide structures of BCL2L11-CCDC170

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6094	NAYYARRDLLSAVE	BCL2L11	CCDC170	chr2	111907724	chr6	151894309	606

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BCL2L11-CCDC170

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6094	NAYYARRDLLSAVE	-5.50071	-6.53601
HLA-B14:02	3BVN	6094	NAYYARRDLLSAVE	-5.44997	-5.56337
HLA-B52:01	3W39	6094	NAYYARRDLLSAVE	-6.87928	-6.99268
HLA-B52:01	3W39	6094	NAYYARRDLLSAVE	-3.95744	-4.99274
HLA-A24:02	5HGA	6094	NAYYARRDLLSAVE	-7.30598	-7.41938
HLA-A24:02	5HGA	6094	NAYYARRDLLSAVE	-5.09366	-6.12896
HLA-B44:05	3DX8	6094	NAYYARRDLLSAVE	-5.64505	-5.75845
HLA-B44:05	3DX8	6094	NAYYARRDLLSAVE	-4.1878	-5.2231
HLA-A02:01	6TDR	6094	NAYYARRDLLSAVE	-0.0912853	-1.12659

Top

Vaccine Design for the FusionNeoAntigens of BCL2L11-CCDC170

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	10	19	ARRDLLSAV	GCAAGGAGGGACCTGCTCAGTGCTGTA
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	11	22	RRDLLSAVEAK	AGGAGGGACCTGCTCAGTGCTGTAGAAGCAAAA
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	12	21	RDLLSAVEA	AGGGACCTGCTCAGTGCTGTAGAAGCA
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	6	15	NAYYARRDL	AACGCTTACTATGCAAGGAGGGACCTG
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	7	15	AYYARRDL	GCTTACTATGCAAGGAGGGACCTG
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	7	16	AYYARRDLL	GCTTACTATGCAAGGAGGGACCTGCTC
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	8	16	YYARRDLL	TACTATGCAAGGAGGGACCTGCTC
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	9	18	YARRDLLSA	TATGCAAGGAGGGACCTGCTCAGTGCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	11	26	RRDLLSAVEAKEALE	AGGAGGGACCTGCTCAGTGCTGTAGAAGCAAAAGAAGCTCTTGAA
BCL2L11-CCDC170	chr2	111907724	chr6	151894309	2	17	GDEFNAYYARRDLLS	GGAGACGAGTTTAACGCTTACTATGCAAGGAGGGACCTGCTCAGT

Top

Information of the samples that have these potential fusion neoantigens of BCL2L11-CCDC170

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	BCL2L11-CCDC170	chr2	111907724	ENST00000308659	chr6	151894309	ENST00000239374	TCGA-25-1323-01A

Top

Potential target of CAR-T therapy development for BCL2L11-CCDC170

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BCL2L11-CCDC170

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BCL2L11-CCDC170

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)