Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TRIM28-CSMD1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TRIM28-CSMD1
	FusionPDB ID: 94031
	FusionGDB2.0 ID: 94031
		Hgene	Tgene
	Gene symbol	TRIM28	CSMD1
	Gene ID	10155	64478
	Gene name	tripartite motif containing 28	CUB and Sushi multiple domains 1
	Synonyms	KAP1\|PPP1R157\|RNF96\|TF1B\|TIF1B	PPP1R24
	Cytomap	19q13.43	8p23.2
	Type of gene	protein-coding	protein-coding
	Description	transcription intermediary factor 1-betaE3 SUMO-protein ligase TRIM28KAP-1KRAB [Kruppel-associated box domain]-associated protein 1KRAB-interacting protein 1KRIP-1RING finger protein 96RING-type E3 ubiquitin transferase TIF1-betaTIF1-betanuclear	CUB and sushi domain-containing protein 1protein phosphatase 1, regulatory subunit 24
	Modification date	20200313	20200313
	UniProtAcc	.	Q96PZ7 Main function of 5'-partner protein: FUNCTION: Potential suppressor of squamous cell carcinomas.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000253024, ENST00000341753,	ENST00000523387, ENST00000400186, ENST00000520002, ENST00000537824, ENST00000539096, ENST00000542608, ENST00000602557, ENST00000602723,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 8 X 5=240	22 X 20 X 8=3520
	# samples	8	23
	** MAII score	log2(8/240*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(23/3520*10)=-3.93586966258028 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TRIM28 [Title/Abstract] AND CSMD1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TRIM28 [Title/Abstract] AND CSMD1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TRIM28(59060607)-CSMD1(3351248), # samples:1
Anticipated loss of major functional domain due to fusion event.	TRIM28-CSMD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM28-CSMD1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM28-CSMD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM28-CSMD1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TRIM28	GO:0006281	DNA repair	17178852
Hgene	TRIM28	GO:0016925	protein sumoylation	18082607
Hgene	TRIM28	GO:0042307	positive regulation of protein import into nucleus	23665872
Hgene	TRIM28	GO:0045087	innate immune response	18248090
Hgene	TRIM28	GO:0045739	positive regulation of DNA repair	17178852
Hgene	TRIM28	GO:0045892	negative regulation of transcription, DNA-templated	9016654
Hgene	TRIM28	GO:1902187	negative regulation of viral release from host cell	18248090

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:59060607/chr8:3351248)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TRIM28 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CSMD1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000602723	CSMD1	chr8	3351248	-	11257	1951	289	10770	3493
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000400186	CSMD1	chr8	3351248	-	11257	1951	289	10770	3493
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000520002	CSMD1	chr8	3351248	-	11788	1951	289	11301	3670
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000602557	CSMD1	chr8	3351248	-	11788	1951	289	11301	3670
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000537824	CSMD1	chr8	3351248	-	11302	1951	289	11301	3671
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000542608	CSMD1	chr8	3351248	-	10771	1951	289	10770	3494
ENST00000253024	TRIM28	chr19	59060607	+	ENST00000539096	CSMD1	chr8	3351248	-	6937	1951	289	6936	2216
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000602723	CSMD1	chr8	3351248	-	11007	1701	285	10520	3411
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000400186	CSMD1	chr8	3351248	-	11007	1701	285	10520	3411
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000520002	CSMD1	chr8	3351248	-	11538	1701	285	11051	3588
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000602557	CSMD1	chr8	3351248	-	11538	1701	285	11051	3588
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000537824	CSMD1	chr8	3351248	-	11052	1701	285	11051	3588
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000542608	CSMD1	chr8	3351248	-	10521	1701	285	10520	3411
ENST00000341753	TRIM28	chr19	59060607	+	ENST00000539096	CSMD1	chr8	3351248	-	6687	1701	285	6686	2133

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000253024	ENST00000602723	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.00135145	0.9986486
ENST00000253024	ENST00000400186	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.00135145	0.9986486
ENST00000253024	ENST00000520002	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001266662	0.99873334
ENST00000253024	ENST00000602557	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001266662	0.99873334
ENST00000253024	ENST00000537824	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001302104	0.9986979
ENST00000253024	ENST00000542608	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001397105	0.9986029
ENST00000253024	ENST00000539096	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.00141511	0.99858487
ENST00000341753	ENST00000602723	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001385762	0.9986142
ENST00000341753	ENST00000400186	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001385762	0.9986142
ENST00000341753	ENST00000520002	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001306142	0.9986939
ENST00000341753	ENST00000602557	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001306142	0.9986939
ENST00000341753	ENST00000537824	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001342274	0.9986577
ENST00000341753	ENST00000542608	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001441822	0.9985582
ENST00000341753	ENST00000539096	TRIM28	chr19	59060607	+	CSMD1	chr8	3351248	-	0.001538673	0.99846137

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TRIM28-CSMD1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TRIM28	chr19	59060607	CSMD1	chr8	3351248	1701	472	PGAPPLAGMAIVKVIKLAFEEFELER
TRIM28	chr19	59060607	CSMD1	chr8	3351248	1951	554	PGAPPLAGMAIVKVIKLAFEEFELER

Top

Potential FusionNeoAntigen Information of TRIM28-CSMD1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TRIM28-CSMD1_59060607_3351248.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:01	IVKVIKLAF	0.9945	0.6783	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B08:01	MAIVKVIKL	0.9929	0.5024	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:03	MAIVKVIKL	0.992	0.7933	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B08:09	MAIVKVIKL	0.9874	0.5143	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B52:01	MAIVKVIKL	0.9856	0.8039	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:02	MAIVKVIKL	0.9731	0.8812	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:04	MAIVKVIKL	0.9731	0.8812	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:25	IVKVIKLAF	0.9671	0.7059	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:02	IVKVIKLAF	0.9657	0.7304	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-A32:13	IVKVIKLAF	0.5188	0.8258	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B57:03	KVIKLAFEEF	0.9988	0.9836	12	22
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-A32:13	KVIKLAFEEF	0.9895	0.9674	12	22
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:08	MAIVKVIKL	0.9998	0.8332	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:19	MAIVKVIKL	0.9997	0.9825	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:07	MAIVKVIKL	0.9996	0.9755	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C15:04	MAIVKVIKL	0.9995	0.862	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C15:06	MAIVKVIKL	0.9994	0.8923	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C04:06	MAIVKVIKL	0.9985	0.6717	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C07:05	MAIVKVIKL	0.9964	0.9324	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C06:03	MAIVKVIKL	0.9946	0.9931	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C08:04	MAIVKVIKL	0.9935	0.9305	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C08:13	MAIVKVIKL	0.9935	0.9305	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C12:12	MAIVKVIKL	0.993	0.9014	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C12:04	MAIVKVIKL	0.9925	0.995	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:14	MAIVKVIKL	0.9919	0.9694	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C12:16	MAIVKVIKL	0.99	0.9711	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C07:13	MAIVKVIKL	0.9879	0.7717	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B51:07	MAIVKVIKL	0.9831	0.7156	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C07:29	MAIVKVIKL	0.9801	0.8922	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C08:03	MAIVKVIKL	0.9762	0.9705	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:12	MAIVKVIKL	0.9731	0.8812	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:04	IVKVIKLAF	0.9543	0.7014	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C02:06	MAIVKVIKL	0.9085	0.9707	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B39:10	MAIVKVIKL	0.7765	0.7208	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B14:03	MAIVKVIKL	0.6193	0.5952	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C01:30	MAIVKVIKL	0.5356	0.9196	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:03	MAIVKVIKL	0.9998	0.9868	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:04	MAIVKVIKL	0.9998	0.9868	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:67	MAIVKVIKL	0.9996	0.9706	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C15:09	MAIVKVIKL	0.9995	0.862	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:02	MAIVKVIKL	0.9995	0.9586	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:05	MAIVKVIKL	0.9994	0.8576	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:17	MAIVKVIKL	0.9994	0.9551	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C15:05	MAIVKVIKL	0.9993	0.8851	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C15:02	MAIVKVIKL	0.9993	0.8453	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C16:04	MAIVKVIKL	0.9987	0.9791	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C07:04	MAIVKVIKL	0.9969	0.9221	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C16:02	MAIVKVIKL	0.9953	0.986	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C12:03	MAIVKVIKL	0.9952	0.9764	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:27	IVKVIKLAF	0.9946	0.6997	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:33	IVKVIKLAF	0.9945	0.6783	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:125	IVKVIKLAF	0.9945	0.6783	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:34	IVKVIKLAF	0.9945	0.6783	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:135	IVKVIKLAF	0.9944	0.6997	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C16:01	MAIVKVIKL	0.9941	0.9662	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C03:06	MAIVKVIKL	0.9938	0.9865	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:35	IVKVIKLAF	0.9934	0.667	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B08:18	MAIVKVIKL	0.9929	0.5024	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C06:02	MAIVKVIKL	0.9928	0.9941	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C06:17	MAIVKVIKL	0.9928	0.9941	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:30	MAIVKVIKL	0.9927	0.5851	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:17	MAIVKVIKL	0.9927	0.5851	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C12:02	MAIVKVIKL	0.9916	0.9775	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:24	IVKVIKLAF	0.9906	0.7103	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:50	IVKVIKLAF	0.9904	0.8175	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:13	MAIVKVIKL	0.9896	0.7973	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C07:22	MAIVKVIKL	0.9858	0.6675	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C08:01	MAIVKVIKL	0.9762	0.9705	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B08:12	MAIVKVIKL	0.9741	0.6023	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B35:09	MAIVKVIKL	0.9731	0.8812	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-A69:01	MAIVKVIKL	0.9508	0.5854	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B15:12	IVKVIKLAF	0.9148	0.6027	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C06:08	MAIVKVIKL	0.8609	0.9893	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-A32:01	IVKVIKLAF	0.8516	0.8725	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C02:10	MAIVKVIKL	0.8342	0.9834	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C02:02	MAIVKVIKL	0.8342	0.9834	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C17:01	MAIVKVIKL	0.7499	0.5913	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-B07:13	MAIVKVIKL	0.3773	0.6944	8	17
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C02:10	IVKVIKLAF	0.1144	0.9061	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-C02:02	IVKVIKLAF	0.1144	0.9061	10	19
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	HLA-A32:01	KVIKLAFEEF	0.9972	0.9721	12	22

Top

Potential FusionNeoAntigen Information of TRIM28-CSMD1 in HLA II

TRIM28-CSMD1_59060607_3351248.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1113	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1377	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1377	GMAIVKVIKLAFEEF	7	22
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1377	LAGMAIVKVIKLAFE	5	20
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1428	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1431	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1432	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1435	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1445	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1455	AGMAIVKVIKLAFEE	6	21
TRIM28-CSMD1	chr19	59060607	chr8	3351248	1951	DRB1-1471	AGMAIVKVIKLAFEE	6	21

Top

Fusion breakpoint peptide structures of TRIM28-CSMD1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
238	AGMAIVKVIKLAFE	TRIM28	CSMD1	chr19	59060607	chr8	3351248	1951

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TRIM28-CSMD1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	238	AGMAIVKVIKLAFE	-5.68508	-5.79848
HLA-B14:02	3BVN	238	AGMAIVKVIKLAFE	-4.48181	-5.51711
HLA-B52:01	3W39	238	AGMAIVKVIKLAFE	-6.58333	-6.69673
HLA-B52:01	3W39	238	AGMAIVKVIKLAFE	-5.63259	-6.66789
HLA-A11:01	4UQ2	238	AGMAIVKVIKLAFE	-10.3303	-10.4437
HLA-A11:01	4UQ2	238	AGMAIVKVIKLAFE	-6.29447	-7.32977
HLA-A24:02	5HGA	238	AGMAIVKVIKLAFE	-7.77035	-7.88375
HLA-A24:02	5HGA	238	AGMAIVKVIKLAFE	-5.35627	-6.39157
HLA-B27:05	6PYJ	238	AGMAIVKVIKLAFE	-3.97515	-5.01045
HLA-B44:05	3DX8	238	AGMAIVKVIKLAFE	-5.81963	-5.93303
HLA-B44:05	3DX8	238	AGMAIVKVIKLAFE	-4.86027	-5.89557
HLA-A02:01	6TDR	238	AGMAIVKVIKLAFE	-5.17978	-6.21508
HLA-A02:01	6TDR	238	AGMAIVKVIKLAFE	-5.36237	-5.47577

Top

Vaccine Design for the FusionNeoAntigens of TRIM28-CSMD1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TRIM28-CSMD1	chr19	59060607	chr8	3351248	10	19	IVKVIKLAF	ATTGTCAAGGTCATCAAGCTTGCCTTT
TRIM28-CSMD1	chr19	59060607	chr8	3351248	12	22	KVIKLAFEEF	AAGGTCATCAAGCTTGCCTTTGAAGAGTTT
TRIM28-CSMD1	chr19	59060607	chr8	3351248	8	17	MAIVKVIKL	ATGGCCATTGTCAAGGTCATCAAGCTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TRIM28-CSMD1	chr19	59060607	chr8	3351248	5	20	LAGMAIVKVIKLAFE	CTGGCTGGCATGGCCATTGTCAAGGTCATCAAGCTTGCCTTTGAA
TRIM28-CSMD1	chr19	59060607	chr8	3351248	6	21	AGMAIVKVIKLAFEE	GCTGGCATGGCCATTGTCAAGGTCATCAAGCTTGCCTTTGAAGAG
TRIM28-CSMD1	chr19	59060607	chr8	3351248	7	22	GMAIVKVIKLAFEEF	GGCATGGCCATTGTCAAGGTCATCAAGCTTGCCTTTGAAGAGTTT

Top

Information of the samples that have these potential fusion neoantigens of TRIM28-CSMD1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	TRIM28-CSMD1	chr19	59060607	ENST00000253024	chr8	3351248	ENST00000400186	TCGA-24-1469

Top

Potential target of CAR-T therapy development for TRIM28-CSMD1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TRIM28-CSMD1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TRIM28-CSMD1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)