![]() |
|||||||
|
Fusion Protein:TRIM33-ABCA4 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: TRIM33-ABCA4 | FusionPDB ID: 94070 | FusionGDB2.0 ID: 94070 | Hgene | Tgene | Gene symbol | TRIM33 | ABCA4 | Gene ID | 51592 | 24 |
Gene name | tripartite motif containing 33 | ATP binding cassette subfamily A member 4 | |
Synonyms | ECTO|PTC7|RFG7|TF1G|TIF1G|TIF1GAMMA|TIFGAMMA | ABC10|ABCR|ARMD2|CORD3|FFM|RMP|RP19|STGD|STGD1 | |
Cytomap | 1p13.2 | 1p22.1 | |
Type of gene | protein-coding | protein-coding | |
Description | E3 ubiquitin-protein ligase TRIM33RET-fused gene 7 proteinRING-type E3 ubiquitin transferase TRIM33TIF1-gammaectodermin homologprotein Rfg7transcriptional intermediary factor 1 gamma | retinal-specific phospholipid-transporting ATPase ABCA4ATP binding cassette transporterATP-binding cassette sub-family A member 4ATP-binding cassette transporter, retinal-specificATP-binding cassette, sub-family A (ABC1), member 4ATP-binding transpor | |
Modification date | 20200313 | 20200315 | |
UniProtAcc | Q9UPN9 Main function of 5'-partner protein: FUNCTION: Acts as an E3 ubiquitin-protein ligase. Promotes SMAD4 ubiquitination, nuclear exclusion and degradation via the ubiquitin proteasome pathway. According to PubMed:16751102, does not promote a decrease in the level of endogenous SMAD4. May act as a transcriptional repressor. Inhibits the transcriptional response to TGF-beta/BMP signaling cascade. Plays a role in the control of cell proliferation. Its association with SMAD2 and SMAD3 stimulates erythroid differentiation of hematopoietic stem/progenitor (By similarity). Monoubiquitinates SMAD4 and acts as an inhibitor of SMAD4-dependent TGF-beta/BMP signaling cascade (Monoubiquitination of SMAD4 hampers its ability to form a stable complex with activated SMAD2/3 resulting in inhibition of TGF-beta/BMP signaling cascade). {ECO:0000250, ECO:0000269|PubMed:10022127, ECO:0000269|PubMed:15820681, ECO:0000269|PubMed:16751102, ECO:0000269|PubMed:19135894}. | P78363 Main function of 5'-partner protein: FUNCTION: Catalyzes the translocation of specific phospholipids from the extracellular/lumenal to the cytoplasmic leaflet of membrane coupled to the hydrolysis of ATP (PubMed:24097981). Transports preferentially phosphatidylethanolamine (PubMed:24097981). In the visual cycle, acts as an inward-directed retinoid flipase, retinoid substrates imported by ABCA4 from the extracellular or intradiscal (rod) membrane surfaces to the cytoplasmic membrane surface are all-trans-retinaldehyde (ATR) and N-retinyl-phosphatidyl-ethanolamine (NR-PE). Once transported to the cytoplasmic surface, ATR is reduced to vitamin A by trans-retinol dehydrogenase (tRDH) and then transferred to the retinal pigment epithelium (RPE) where it is converted to 11-cis-retinal. May play a role in photoresponse, removing ATR/NR-PE from the extracellular photoreceptor surfaces during bleach recovery. {ECO:0000269|PubMed:10075733, ECO:0000269|PubMed:24097981}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000358465, ENST00000369543, ENST00000450349, ENST00000476908, | ENST00000465352, ENST00000535735, ENST00000535881, ENST00000536513, ENST00000370225, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 17 X 18 X 10=3060 | 4 X 5 X 5=100 |
# samples | 21 | 7 | |
** MAII score | log2(21/3060*10)=-3.86507041991389 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/100*10)=-0.514573172829758 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: TRIM33 [Title/Abstract] AND ABCA4 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TRIM33 [Title/Abstract] AND ABCA4 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TRIM33(115053172)-ABCA4(94458798), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. TRIM33-ABCA4 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TRIM33 | GO:0016567 | protein ubiquitination | 19135894 |
Hgene | TRIM33 | GO:0017015 | regulation of transforming growth factor beta receptor signaling pathway | 19135894 |
Hgene | TRIM33 | GO:0030514 | negative regulation of BMP signaling pathway | 19135894 |
Tgene | ABCA4 | GO:0045332 | phospholipid translocation | 24097981 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:115053172/chr1:94458798) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000358465 | TRIM33 | chr1 | 115053172 | - | ENST00000370225 | ABCA4 | chr1 | 94458798 | - | 1016 | 610 | 0 | 824 | 274 |
ENST00000369543 | TRIM33 | chr1 | 115053172 | - | ENST00000370225 | ABCA4 | chr1 | 94458798 | - | 1016 | 610 | 0 | 824 | 274 |
ENST00000358465 | TRIM33 | chr1 | 115053171 | - | ENST00000370225 | ABCA4 | chr1 | 94458798 | - | 1016 | 610 | 0 | 824 | 274 |
ENST00000369543 | TRIM33 | chr1 | 115053171 | - | ENST00000370225 | ABCA4 | chr1 | 94458798 | - | 1016 | 610 | 0 | 824 | 274 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000358465 | ENST00000370225 | TRIM33 | chr1 | 115053172 | - | ABCA4 | chr1 | 94458798 | - | 0.014717526 | 0.9852824 |
ENST00000369543 | ENST00000370225 | TRIM33 | chr1 | 115053172 | - | ABCA4 | chr1 | 94458798 | - | 0.014717526 | 0.9852824 |
ENST00000358465 | ENST00000370225 | TRIM33 | chr1 | 115053171 | - | ABCA4 | chr1 | 94458798 | - | 0.014717526 | 0.9852824 |
ENST00000369543 | ENST00000370225 | TRIM33 | chr1 | 115053171 | - | ABCA4 | chr1 | 94458798 | - | 0.014717526 | 0.9852824 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TRIM33-ABCA4 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TRIM33 | chr1 | 115053171 | ABCA4 | chr1 | 94458798 | 610 | 203 | VPIPGGSNGDIQQGLIFHTARSCSQK |
TRIM33 | chr1 | 115053172 | ABCA4 | chr1 | 94458798 | 610 | 203 | VPIPGGSNGDIQQGLIFHTARSCSQK |
Top |
Potential FusionNeoAntigen Information of TRIM33-ABCA4 in HLA I |
![]() |
TRIM33-ABCA4_115053171_94458798.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | HLA-B39:06 | QQGLIFHTA | 0.7665 | 0.8838 | 11 | 20 |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | HLA-B13:02 | QQGLIFHTA | 0.6793 | 0.8988 | 11 | 20 |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | HLA-B47:01 | GDIQQGLIF | 0.6086 | 0.6519 | 8 | 17 |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | HLA-C08:15 | NGDIQQGL | 0.9999 | 0.9733 | 7 | 15 |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | HLA-C08:02 | NGDIQQGL | 0.9999 | 0.9733 | 7 | 15 |
Top |
Potential FusionNeoAntigen Information of TRIM33-ABCA4 in HLA II |
![]() |
TRIM33-ABCA4_115053171_94458798.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | DRB1-0103 | QQGLIFHTARSCSQK | 11 | 26 |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 | DRB1-1367 | QQGLIFHTARSCSQK | 11 | 26 |
Top |
Fusion breakpoint peptide structures of TRIM33-ABCA4 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8850 | SNGDIQQGLIFHTA | TRIM33 | ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 610 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TRIM33-ABCA4 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8850 | SNGDIQQGLIFHTA | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 8850 | SNGDIQQGLIFHTA | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 8850 | SNGDIQQGLIFHTA | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 8850 | SNGDIQQGLIFHTA | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 8850 | SNGDIQQGLIFHTA | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 8850 | SNGDIQQGLIFHTA | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 8850 | SNGDIQQGLIFHTA | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 8850 | SNGDIQQGLIFHTA | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 8850 | SNGDIQQGLIFHTA | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 8850 | SNGDIQQGLIFHTA | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 8850 | SNGDIQQGLIFHTA | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of TRIM33-ABCA4 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 11 | 20 | QQGLIFHTA | AGCAAGGACTGATCTTTCACACCGCTC |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 7 | 15 | NGDIQQGL | ACGGCGACATCCAGCAAGGACTGA |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 8 | 17 | GDIQQGLIF | GCGACATCCAGCAAGGACTGATCTTTC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
TRIM33-ABCA4 | chr1 | 115053171 | chr1 | 94458798 | 11 | 26 | QQGLIFHTARSCSQK | AGCAAGGACTGATCTTTCACACCGCTCGTTCCTGCAGCCAGAAAG |
Top |
Information of the samples that have these potential fusion neoantigens of TRIM33-ABCA4 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | TRIM33-ABCA4 | chr1 | 115053171 | ENST00000358465 | chr1 | 94458798 | ENST00000370225 | TCGA-04-1347 |
Top |
Potential target of CAR-T therapy development for TRIM33-ABCA4 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TRIM33-ABCA4 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TRIM33-ABCA4 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | TRIM33 | C0238463 | Papillary thyroid carcinoma | 2 | ORPHANET |