![]() |
|||||||
|
Fusion Protein:TRPC4AP-ADNP |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: TRPC4AP-ADNP | FusionPDB ID: 94337 | FusionGDB2.0 ID: 94337 | Hgene | Tgene | Gene symbol | TRPC4AP | ADNP | Gene ID | 26133 | 23394 |
Gene name | transient receptor potential cation channel subfamily C member 4 associated protein | activity dependent neuroprotector homeobox | |
Synonyms | C20orf188|PPP1R158|TRRP4AP|TRUSS | ADNP1|HVDAS|MRD28 | |
Cytomap | 20q11.22 | 20q13.13 | |
Type of gene | protein-coding | protein-coding | |
Description | short transient receptor potential channel 4-associated proteinTNF-receptor ubiquitous scaffolding/signaling proteinTRP4-associated proteinprotein phosphatase 1, regulatory subunit 158trpc4-associated proteintumor necrosis factor receptor-associated | activity-dependent neuroprotector homeobox proteinADNP homeobox 1activity-dependent neuroprotective proteinactivity-dependent neuroprotector | |
Modification date | 20200313 | 20200322 | |
UniProtAcc | . | Q6IQ32 Main function of 5'-partner protein: FUNCTION: May be involved in transcriptional regulation. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000252015, ENST00000432634, ENST00000451813, ENST00000539834, | ENST00000396029, ENST00000349014, ENST00000371602, ENST00000396032, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 30 X 25 X 10=7500 | 10 X 8 X 5=400 |
# samples | 33 | 9 | |
** MAII score | log2(33/7500*10)=-4.50635266602479 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(9/400*10)=-2.15200309344505 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: TRPC4AP [Title/Abstract] AND ADNP [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TRPC4AP [Title/Abstract] AND ADNP [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TRPC4AP(33680417)-ADNP(49511049), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | TRPC4AP-ADNP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. TRPC4AP-ADNP seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TRPC4AP | GO:0006511 | ubiquitin-dependent protein catabolic process | 20551172 |
Hgene | TRPC4AP | GO:0016567 | protein ubiquitination | 20551172 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:33680417/chr20:49511049) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000451813 | TRPC4AP | chr20 | 33680417 | - | ENST00000396032 | ADNP | chr20 | 49511049 | - | 4404 | 194 | 5 | 3301 | 1098 |
ENST00000451813 | TRPC4AP | chr20 | 33680417 | - | ENST00000371602 | ADNP | chr20 | 49511049 | - | 5659 | 194 | 5 | 3301 | 1098 |
ENST00000451813 | TRPC4AP | chr20 | 33680417 | - | ENST00000349014 | ADNP | chr20 | 49511049 | - | 5659 | 194 | 5 | 3301 | 1098 |
ENST00000252015 | TRPC4AP | chr20 | 33680417 | - | ENST00000396032 | ADNP | chr20 | 49511049 | - | 4468 | 258 | 69 | 3365 | 1098 |
ENST00000252015 | TRPC4AP | chr20 | 33680417 | - | ENST00000371602 | ADNP | chr20 | 49511049 | - | 5723 | 258 | 69 | 3365 | 1098 |
ENST00000252015 | TRPC4AP | chr20 | 33680417 | - | ENST00000349014 | ADNP | chr20 | 49511049 | - | 5723 | 258 | 69 | 3365 | 1098 |
ENST00000432634 | TRPC4AP | chr20 | 33680417 | - | ENST00000396032 | ADNP | chr20 | 49511049 | - | 4404 | 194 | 5 | 3301 | 1098 |
ENST00000432634 | TRPC4AP | chr20 | 33680417 | - | ENST00000371602 | ADNP | chr20 | 49511049 | - | 5659 | 194 | 5 | 3301 | 1098 |
ENST00000432634 | TRPC4AP | chr20 | 33680417 | - | ENST00000349014 | ADNP | chr20 | 49511049 | - | 5659 | 194 | 5 | 3301 | 1098 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000451813 | ENST00000396032 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000293273 | 0.9997067 |
ENST00000451813 | ENST00000371602 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000207201 | 0.9997929 |
ENST00000451813 | ENST00000349014 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000207201 | 0.9997929 |
ENST00000252015 | ENST00000396032 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000323844 | 0.9996762 |
ENST00000252015 | ENST00000371602 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000228659 | 0.9997713 |
ENST00000252015 | ENST00000349014 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000228659 | 0.9997713 |
ENST00000432634 | ENST00000396032 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000293273 | 0.9997067 |
ENST00000432634 | ENST00000371602 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000207201 | 0.9997929 |
ENST00000432634 | ENST00000349014 | TRPC4AP | chr20 | 33680417 | - | ADNP | chr20 | 49511049 | - | 0.000207201 | 0.9997929 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TRPC4AP-ADNP |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TRPC4AP | chr20 | 33680417 | ADNP | chr20 | 49511049 | 194 | 63 | GQLTGRGLVRAVQDYRTKPFCCSACP |
TRPC4AP | chr20 | 33680417 | ADNP | chr20 | 49511049 | 258 | 63 | GQLTGRGLVRAVQDYRTKPFCCSACP |
Top |
Potential FusionNeoAntigen Information of TRPC4AP-ADNP in HLA I |
![]() |
TRPC4AP-ADNP_33680417_49511049.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:01 | GLVRAVQDY | 0.9919 | 0.8131 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-A30:08 | RAVQDYRTK | 0.9591 | 0.6055 | 9 | 18 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:25 | GLVRAVQDY | 0.927 | 0.8695 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:03 | VQDYRTKPF | 0.8031 | 0.6967 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-C08:15 | VQDYRTKPF | 0.9962 | 0.9678 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:07 | GLVRAVQDY | 0.9413 | 0.6655 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:05 | GLVRAVQDY | 0.4955 | 0.8514 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-C08:02 | VQDYRTKPF | 0.9962 | 0.9678 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:27 | GLVRAVQDY | 0.992 | 0.8658 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:125 | GLVRAVQDY | 0.9919 | 0.8131 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:34 | GLVRAVQDY | 0.9919 | 0.8131 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:50 | GLVRAVQDY | 0.9919 | 0.807 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:33 | GLVRAVQDY | 0.9919 | 0.8131 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:135 | GLVRAVQDY | 0.9916 | 0.8478 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:35 | GLVRAVQDY | 0.97 | 0.8621 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-A30:01 | RAVQDYRTK | 0.9593 | 0.7488 | 9 | 18 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:39 | GLVRAVQDY | 0.9333 | 0.7627 | 6 | 15 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:53 | VQDYRTKPF | 0.8095 | 0.8332 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:54 | VQDYRTKPF | 0.7594 | 0.7949 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B48:02 | VQDYRTKPF | 0.6303 | 0.8913 | 11 | 20 |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 | HLA-B15:20 | GLVRAVQDY | 0.4983 | 0.9085 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of TRPC4AP-ADNP in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of TRPC4AP-ADNP |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2971 | GLVRAVQDYRTKPF | TRPC4AP | ADNP | chr20 | 33680417 | chr20 | 49511049 | 258 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TRPC4AP-ADNP |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2971 | GLVRAVQDYRTKPF | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 2971 | GLVRAVQDYRTKPF | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 2971 | GLVRAVQDYRTKPF | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 2971 | GLVRAVQDYRTKPF | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 2971 | GLVRAVQDYRTKPF | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 2971 | GLVRAVQDYRTKPF | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 2971 | GLVRAVQDYRTKPF | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 2971 | GLVRAVQDYRTKPF | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 2971 | GLVRAVQDYRTKPF | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 2971 | GLVRAVQDYRTKPF | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 2971 | GLVRAVQDYRTKPF | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of TRPC4AP-ADNP |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 11 | 20 | VQDYRTKPF | GTGCAGGACTATCGGACAAAACCTTTC |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 6 | 15 | GLVRAVQDY | GGCCTGGTCCGGGCGGTGCAGGACTAT |
TRPC4AP-ADNP | chr20 | 33680417 | chr20 | 49511049 | 9 | 18 | RAVQDYRTK | CGGGCGGTGCAGGACTATCGGACAAAA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of TRPC4AP-ADNP |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | TRPC4AP-ADNP | chr20 | 33680417 | ENST00000252015 | chr20 | 49511049 | ENST00000349014 | TCGA-91-6831-01A |
Top |
Potential target of CAR-T therapy development for TRPC4AP-ADNP |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TRPC4AP-ADNP |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TRPC4AP-ADNP |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |