Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TSHR-YAP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TSHR-YAP1
	FusionPDB ID: 94584
	FusionGDB2.0 ID: 94584
		Hgene	Tgene
	Gene symbol	TSHR	YAP1
	Gene ID	7253	10413
	Gene name	thyroid stimulating hormone receptor	Yes1 associated transcriptional regulator
	Synonyms	CHNG1\|LGR3\|hTSHR-I	COB1\|YAP\|YAP2\|YAP65\|YKI
	Cytomap	14q31.1	11q22.1
	Type of gene	protein-coding	protein-coding
	Description	thyrotropin receptorTSH receptorseven transmembrane helix receptorthyrotropin receptor-I, hTSHR-I	transcriptional coactivator YAP165 kDa Yes-associated proteinYes associated protein 1protein yorkie homologyes-associated protein 1yes-associated protein 2yes-associated protein YAP65 homologyorkie homolog
	Modification date	20200329	20200329
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000557096, ENST00000298171, ENST00000342443, ENST00000541158, ENST00000554263, ENST00000554435,	ENST00000282441, ENST00000345877, ENST00000524575, ENST00000526343, ENST00000531439, ENST00000537274, ENST00000528834,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 4 X 2=40	20 X 10 X 13=2600
	# samples	5	21
	** MAII score	log2(5/40*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(21/2600*10)=-3.63005039024969 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TSHR [Title/Abstract] AND YAP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TSHR [Title/Abstract] AND YAP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TSHR(81422194)-YAP1(102033186), # samples:2
Anticipated loss of major functional domain due to fusion event.	TSHR-YAP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSHR-YAP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSHR-YAP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TSHR-YAP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	YAP1	GO:0006974	cellular response to DNA damage stimulus	18280240
Tgene	YAP1	GO:0008283	cell proliferation	17974916
Tgene	YAP1	GO:0032570	response to progesterone	16772533
Tgene	YAP1	GO:0033148	positive regulation of intracellular estrogen receptor signaling pathway	16772533
Tgene	YAP1	GO:0045893	positive regulation of transcription, DNA-templated	20368466
Tgene	YAP1	GO:0045944	positive regulation of transcription by RNA polymerase II	25796446
Tgene	YAP1	GO:0050767	regulation of neurogenesis	25433207
Tgene	YAP1	GO:0050847	progesterone receptor signaling pathway	16772533
Tgene	YAP1	GO:0060242	contact inhibition	17974916
Tgene	YAP1	GO:0065003	protein-containing complex assembly	20368466
Tgene	YAP1	GO:0071480	cellular response to gamma radiation	18280240
Tgene	YAP1	GO:0072091	regulation of stem cell proliferation	25433207

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:81422194/chr11:102033186)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TSHR (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across YAP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000541158	TSHR	chr14	81422194	+	ENST00000526343	YAP1	chr11	102033186	+	1925	492	322	1272	316
ENST00000541158	TSHR	chr14	81422194	+	ENST00000282441	YAP1	chr11	102033186	+	4918	492	322	1434	370
ENST00000541158	TSHR	chr14	81422194	+	ENST00000537274	YAP1	chr11	102033186	+	4882	492	322	1398	358
ENST00000541158	TSHR	chr14	81422194	+	ENST00000345877	YAP1	chr11	102033186	+	4768	492	322	1284	320
ENST00000541158	TSHR	chr14	81422194	+	ENST00000531439	YAP1	chr11	102033186	+	1410	492	322	1386	354
ENST00000541158	TSHR	chr14	81422194	+	ENST00000524575	YAP1	chr11	102033186	+	1647	492	322	1434	370
ENST00000342443	TSHR	chr14	81422194	+	ENST00000526343	YAP1	chr11	102033186	+	1853	420	250	1200	316
ENST00000342443	TSHR	chr14	81422194	+	ENST00000282441	YAP1	chr11	102033186	+	4846	420	250	1362	370
ENST00000342443	TSHR	chr14	81422194	+	ENST00000537274	YAP1	chr11	102033186	+	4810	420	250	1326	358
ENST00000342443	TSHR	chr14	81422194	+	ENST00000345877	YAP1	chr11	102033186	+	4696	420	250	1212	320
ENST00000342443	TSHR	chr14	81422194	+	ENST00000531439	YAP1	chr11	102033186	+	1338	420	250	1314	354
ENST00000342443	TSHR	chr14	81422194	+	ENST00000524575	YAP1	chr11	102033186	+	1575	420	250	1362	370
ENST00000298171	TSHR	chr14	81422194	+	ENST00000526343	YAP1	chr11	102033186	+	1759	326	156	1106	316
ENST00000298171	TSHR	chr14	81422194	+	ENST00000282441	YAP1	chr11	102033186	+	4752	326	156	1268	370
ENST00000298171	TSHR	chr14	81422194	+	ENST00000537274	YAP1	chr11	102033186	+	4716	326	156	1232	358
ENST00000298171	TSHR	chr14	81422194	+	ENST00000345877	YAP1	chr11	102033186	+	4602	326	156	1118	320
ENST00000298171	TSHR	chr14	81422194	+	ENST00000531439	YAP1	chr11	102033186	+	1244	326	156	1220	354
ENST00000298171	TSHR	chr14	81422194	+	ENST00000524575	YAP1	chr11	102033186	+	1481	326	156	1268	370
ENST00000554263	TSHR	chr14	81422194	+	ENST00000526343	YAP1	chr11	102033186	+	1629	196	26	976	316
ENST00000554263	TSHR	chr14	81422194	+	ENST00000282441	YAP1	chr11	102033186	+	4622	196	26	1138	370
ENST00000554263	TSHR	chr14	81422194	+	ENST00000537274	YAP1	chr11	102033186	+	4586	196	26	1102	358
ENST00000554263	TSHR	chr14	81422194	+	ENST00000345877	YAP1	chr11	102033186	+	4472	196	26	988	320
ENST00000554263	TSHR	chr14	81422194	+	ENST00000531439	YAP1	chr11	102033186	+	1114	196	26	1090	354
ENST00000554263	TSHR	chr14	81422194	+	ENST00000524575	YAP1	chr11	102033186	+	1351	196	26	1138	370
ENST00000554435	TSHR	chr14	81422194	+	ENST00000526343	YAP1	chr11	102033186	+	1629	196	26	976	316
ENST00000554435	TSHR	chr14	81422194	+	ENST00000282441	YAP1	chr11	102033186	+	4622	196	26	1138	370
ENST00000554435	TSHR	chr14	81422194	+	ENST00000537274	YAP1	chr11	102033186	+	4586	196	26	1102	358
ENST00000554435	TSHR	chr14	81422194	+	ENST00000345877	YAP1	chr11	102033186	+	4472	196	26	988	320
ENST00000554435	TSHR	chr14	81422194	+	ENST00000531439	YAP1	chr11	102033186	+	1114	196	26	1090	354
ENST00000554435	TSHR	chr14	81422194	+	ENST00000524575	YAP1	chr11	102033186	+	1351	196	26	1138	370

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000541158	ENST00000526343	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.002840422	0.9971596
ENST00000541158	ENST00000282441	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000146302	0.99985373
ENST00000541158	ENST00000537274	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000157819	0.99984217
ENST00000541158	ENST00000345877	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000148531	0.99985147
ENST00000541158	ENST00000531439	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.005345727	0.9946543
ENST00000541158	ENST00000524575	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.004304797	0.99569523
ENST00000342443	ENST00000526343	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.002992745	0.9970073
ENST00000342443	ENST00000282441	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.00013736	0.9998627
ENST00000342443	ENST00000537274	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000147831	0.9998522
ENST00000342443	ENST00000345877	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000138774	0.99986124
ENST00000342443	ENST00000531439	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.005918373	0.9940817
ENST00000342443	ENST00000524575	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.004667528	0.9953324
ENST00000298171	ENST00000526343	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.002625063	0.9973749
ENST00000298171	ENST00000282441	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000131436	0.9998685
ENST00000298171	ENST00000537274	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000142118	0.9998579
ENST00000298171	ENST00000345877	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.00013316	0.99986684
ENST00000298171	ENST00000531439	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.005915986	0.99408406
ENST00000298171	ENST00000524575	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.004557533	0.9954425
ENST00000554263	ENST00000526343	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.001826201	0.99817383
ENST00000554263	ENST00000282441	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000127094	0.9998729
ENST00000554263	ENST00000537274	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000136556	0.9998634
ENST00000554263	ENST00000345877	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000127427	0.99987257
ENST00000554263	ENST00000531439	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.002640623	0.99735934
ENST00000554263	ENST00000524575	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.00237154	0.9976285
ENST00000554435	ENST00000526343	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.001826201	0.99817383
ENST00000554435	ENST00000282441	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000127094	0.9998729
ENST00000554435	ENST00000537274	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000136556	0.9998634
ENST00000554435	ENST00000345877	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.000127427	0.99987257
ENST00000554435	ENST00000531439	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.002640623	0.99735934
ENST00000554435	ENST00000524575	TSHR	chr14	81422194	+	YAP1	chr11	102033186	+	0.00237154	0.9976285

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TSHR-YAP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TSHR	chr14	81422194	YAP1	chr11	102033186	196	57	QRIPSLPPSTQTLHIDQTTTWQDPRK
TSHR	chr14	81422194	YAP1	chr11	102033186	326	57	QRIPSLPPSTQTLHIDQTTTWQDPRK
TSHR	chr14	81422194	YAP1	chr11	102033186	420	57	QRIPSLPPSTQTLHIDQTTTWQDPRK
TSHR	chr14	81422194	YAP1	chr11	102033186	492	57	QRIPSLPPSTQTLHIDQTTTWQDPRK

Top

Potential FusionNeoAntigen Information of TSHR-YAP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TSHR-YAP1_81422194_102033186.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:01	LHIDQTTTW	0.9438	0.9918	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:01	LHIDQTTTW	0.9412	0.9971	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:02	LHIDQTTTW	0.9239	0.9976	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:10	LHIDQTTTW	0.7553	0.8917	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B53:01	LHIDQTTTW	0.7388	0.8119	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:18	LHIDQTTTW	0.6835	0.9109	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B58:02	LHIDQTTTW	0.6822	0.9886	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A24:15	LHIDQTTTW	0.6225	0.7772	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A24:31	LHIDQTTTW	0.5874	0.7688	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A31:08	LHIDQTTTW	0.5406	0.8946	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A24:17	LHIDQTTTW	0.5397	0.8546	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:37	LHIDQTTTW	0.5197	0.8828	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A24:14	LHIDQTTTW	0.2858	0.7724	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B58:01	TLHIDQTTTW	0.9757	0.9946	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:18	TLHIDQTTTW	0.9195	0.9471	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A32:13	TLHIDQTTTW	0.8652	0.9969	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:01	TLHIDQTTTW	0.2622	0.9972	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:02	TLHIDQTTTW	0.2198	0.9975	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B57:01	QTLHIDQTTTW	0.9999	0.9949	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B58:02	QTLHIDQTTTW	0.9996	0.9942	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B58:01	QTLHIDQTTTW	0.9993	0.9918	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:16	QTLHIDQTTTW	0.9985	0.8787	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:17	QTLHIDQTTTW	0.9976	0.9366	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B57:03	QTLHIDQTTTW	0.9975	0.9974	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A32:13	QTLHIDQTTTW	0.9735	0.9928	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:01	QTLHIDQTTTW	0.3086	0.9981	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:02	QTLHIDQTTTW	0.2988	0.9981	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:12	LHIDQTTTW	0.9456	0.9926	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:09	LHIDQTTTW	0.93	0.924	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:05	LHIDQTTTW	0.904	0.9907	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C07:95	LHIDQTTTW	0.7665	0.9469	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A23:01	LHIDQTTTW	0.6284	0.5143	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C07:10	LHIDQTTTW	0.5853	0.9942	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:21	LHIDQTTTW	0.4883	0.9349	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:17	SLPPSTQTLH	0.7241	0.9201	4	14
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B44:08	TLHIDQTTTW	0.7096	0.9337	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B44:06	TLHIDQTTTW	0.6932	0.7562	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:30	SLPPSTQTLH	0.6814	0.9388	4	14
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B44:06	QTLHIDQTTTW	0.9619	0.8425	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:30	SLPPSTQTLHI	0.7646	0.933	4	15
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:17	SLPPSTQTLHI	0.7267	0.9161	4	15
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:05	LHIDQTTTW	0.9412	0.9971	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:31	LHIDQTTTW	0.9345	0.992	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B48:02	LHIDQTTTW	0.744	0.9175	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C07:22	LHIDQTTTW	0.72	0.9119	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B53:02	LHIDQTTTW	0.7118	0.8262	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:13	LHIDQTTTW	0.6391	0.941	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:09	LHIDQTTTW	0.6248	0.899	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B39:11	LHIDQTTTW	0.4538	0.9097	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:24	LHIDQTTTW	0.2555	0.9897	12	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:24	TLHIDQTTTW	0.9988	0.9855	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:13	TLHIDQTTTW	0.9527	0.8996	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A32:01	TLHIDQTTTW	0.9211	0.9979	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:03	SLPPSTQTLH	0.7707	0.869	4	14
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:02	SLPPSTQTLH	0.7399	0.9174	4	14
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A25:01	TLHIDQTTTW	0.5306	0.9769	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:05	TLHIDQTTTW	0.2622	0.9972	11	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B57:10	QTLHIDQTTTW	0.9999	0.9949	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B57:04	QTLHIDQTTTW	0.9997	0.9471	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B58:06	QTLHIDQTTTW	0.9994	0.9686	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B57:02	QTLHIDQTTTW	0.9977	0.9958	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:24	QTLHIDQTTTW	0.9965	0.8758	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B15:13	QTLHIDQTTTW	0.9931	0.8102	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A32:01	QTLHIDQTTTW	0.9904	0.9947	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:03	SLPPSTQTLHI	0.8738	0.8588	4	15
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-A25:01	QTLHIDQTTTW	0.7855	0.9538	10	21
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-C01:02	SLPPSTQTLHI	0.7426	0.9124	4	15
TSHR-YAP1	chr14	81422194	chr11	102033186	326	HLA-B38:05	QTLHIDQTTTW	0.3086	0.9981	10	21

Top

Potential FusionNeoAntigen Information of TSHR-YAP1 in HLA II

TSHR-YAP1_81422194_102033186.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TSHR-YAP1	chr14	81422194	chr11	102033186	326	DRB1-0411	TLHIDQTTTWQDPRK	11	26
TSHR-YAP1	chr14	81422194	chr11	102033186	326	DRB1-0467	TLHIDQTTTWQDPRK	11	26
TSHR-YAP1	chr14	81422194	chr11	102033186	326	DRB1-0491	TLHIDQTTTWQDPRK	11	26
TSHR-YAP1	chr14	81422194	chr11	102033186	326	DRB1-1410	TLHIDQTTTWQDPRK	11	26

Top

Fusion breakpoint peptide structures of TSHR-YAP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6892	PPSTQTLHIDQTTT	TSHR	YAP1	chr14	81422194	chr11	102033186	326

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TSHR-YAP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6892	PPSTQTLHIDQTTT	-7.9962	-8.1096
HLA-B14:02	3BVN	6892	PPSTQTLHIDQTTT	-5.70842	-6.74372
HLA-B52:01	3W39	6892	PPSTQTLHIDQTTT	-6.83737	-6.95077
HLA-B52:01	3W39	6892	PPSTQTLHIDQTTT	-4.4836	-5.5189
HLA-A11:01	4UQ2	6892	PPSTQTLHIDQTTT	-10.0067	-10.1201
HLA-A11:01	4UQ2	6892	PPSTQTLHIDQTTT	-9.03915	-10.0745
HLA-A24:02	5HGA	6892	PPSTQTLHIDQTTT	-6.56204	-6.67544
HLA-A24:02	5HGA	6892	PPSTQTLHIDQTTT	-5.42271	-6.45801
HLA-B44:05	3DX8	6892	PPSTQTLHIDQTTT	-7.85648	-8.89178
HLA-B44:05	3DX8	6892	PPSTQTLHIDQTTT	-5.3978	-5.5112
HLA-A02:01	6TDR	6892	PPSTQTLHIDQTTT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TSHR-YAP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TSHR-YAP1	chr14	81422194	chr11	102033186	10	21	QTLHIDQTTTW	GCAGACTCTTCACATCGATCAGACAACAACATG
TSHR-YAP1	chr14	81422194	chr11	102033186	11	21	TLHIDQTTTW	GACTCTTCACATCGATCAGACAACAACATG
TSHR-YAP1	chr14	81422194	chr11	102033186	12	21	LHIDQTTTW	TCTTCACATCGATCAGACAACAACATG
TSHR-YAP1	chr14	81422194	chr11	102033186	4	14	SLPPSTQTLH	CAGCTTACCGCCCAGTACGCAGACTCTTCA
TSHR-YAP1	chr14	81422194	chr11	102033186	4	15	SLPPSTQTLHI	CAGCTTACCGCCCAGTACGCAGACTCTTCACAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TSHR-YAP1	chr14	81422194	chr11	102033186	11	26	TLHIDQTTTWQDPRK	GACTCTTCACATCGATCAGACAACAACATGGCAGGACCCCAGGAA

Top

Information of the samples that have these potential fusion neoantigens of TSHR-YAP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
THCA	TSHR-YAP1	chr14	81422194	ENST00000298171	chr11	102033186	ENST00000282441	TCGA-DJ-A2PX

Top

Potential target of CAR-T therapy development for TSHR-YAP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TSHR-YAP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TSHR-YAP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)