Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TTLL5-JDP2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TTLL5-JDP2
	FusionPDB ID: 95182
	FusionGDB2.0 ID: 95182
		Hgene	Tgene
	Gene symbol	TTLL5	JDP2
	Gene ID	254173	122953
	Gene name	tubulin tyrosine ligase like 10	Jun dimerization protein 2
	Synonyms	TTLL5	JUNDM2
	Cytomap	1p36.33	14q24.3
	Type of gene	protein-coding	protein-coding
	Description	inactive polyglycylase TTLL10tubulin tyrosine ligase-like family, member 10tubulin tyrosine ligase-like family, member 5tubulin--tyrosine ligase-like protein 10	jun dimerization protein 2progesterone receptor co-activator
	Modification date	20200313	20200313
	UniProtAcc	.	Q8WYK2 Main function of 5'-partner protein: FUNCTION: Component of the AP-1 transcription factor that represses transactivation mediated by the Jun family of proteins. Involved in a variety of transcriptional responses associated with AP-1 such as UV-induced apoptosis, cell differentiation, tumorigenesis and antitumogeneris. Can also function as a repressor by recruiting histone deacetylase 3/HDAC3 to the promoter region of JUN. May control transcription via direct regulation of the modification of histones and the assembly of chromatin. {ECO:0000269\|PubMed:12707301, ECO:0000269\|PubMed:12903123, ECO:0000269\|PubMed:16026868, ECO:0000269\|PubMed:16518400}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000286650, ENST00000298832, ENST00000556977, ENST00000557636, ENST00000554510, ENST00000556893, ENST00000555422,	ENST00000559773, ENST00000267569, ENST00000419727, ENST00000435893, ENST00000437176,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	22 X 22 X 16=7744	4 X 5 X 4=80
	# samples	31	6
	** MAII score	log2(31/7744*10)=-4.64273883200036 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/80*10)=-0.415037499278844 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TTLL5 [Title/Abstract] AND JDP2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TTLL5 [Title/Abstract] AND JDP2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TTLL5(76259443)-JDP2(75928128), # samples:2 TTLL5(76129566)-JDP2(75904601), # samples:2
Anticipated loss of major functional domain due to fusion event.	TTLL5-JDP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TTLL5-JDP2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TTLL5-JDP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TTLL5-JDP2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TTLL5	GO:0018094	protein polyglycylation	19524510
Tgene	JDP2	GO:0000122	negative regulation of transcription by RNA polymerase II	18671972

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:76259443/chr14:75928128)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TTLL5 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across JDP2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000557636	TTLL5	chr14	76259443	+	ENST00000419727	JDP2	chr14	75928128	+	4045	3431	215	3721	1168
ENST00000298832	TTLL5	chr14	76259443	+	ENST00000419727	JDP2	chr14	75928128	+	3990	3376	205	3666	1153
ENST00000556893	TTLL5	chr14	76259443	+	ENST00000419727	JDP2	chr14	75928128	+	2508	1894	43	2184	713
ENST00000554510	TTLL5	chr14	76259443	+	ENST00000419727	JDP2	chr14	75928128	+	2431	1817	119	2107	662
ENST00000557636	TTLL5	chr14	76259443	-	ENST00000419727	JDP2	chr14	75928129	+	4045	3431	215	3721	1168
ENST00000298832	TTLL5	chr14	76259443	-	ENST00000419727	JDP2	chr14	75928129	+	3990	3376	205	3666	1153
ENST00000556893	TTLL5	chr14	76259443	-	ENST00000419727	JDP2	chr14	75928129	+	2508	1894	43	2184	713
ENST00000554510	TTLL5	chr14	76259443	-	ENST00000419727	JDP2	chr14	75928129	+	2431	1817	119	2107	662

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000557636	ENST00000419727	TTLL5	chr14	76259443	+	JDP2	chr14	75928128	+	0.002817678	0.99718237
ENST00000298832	ENST00000419727	TTLL5	chr14	76259443	+	JDP2	chr14	75928128	+	0.002307999	0.997692
ENST00000556893	ENST00000419727	TTLL5	chr14	76259443	+	JDP2	chr14	75928128	+	0.011834865	0.98816514
ENST00000554510	ENST00000419727	TTLL5	chr14	76259443	+	JDP2	chr14	75928128	+	0.030917421	0.96908253
ENST00000557636	ENST00000419727	TTLL5	chr14	76259443	-	JDP2	chr14	75928129	+	0.002817678	0.99718237
ENST00000298832	ENST00000419727	TTLL5	chr14	76259443	-	JDP2	chr14	75928129	+	0.002307999	0.997692
ENST00000556893	ENST00000419727	TTLL5	chr14	76259443	-	JDP2	chr14	75928129	+	0.011834865	0.98816514
ENST00000554510	ENST00000419727	TTLL5	chr14	76259443	-	JDP2	chr14	75928129	+	0.030917421	0.96908253

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TTLL5-JDP2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TTLL5	chr14	76259443	JDP2	chr14	75928128	1817	565	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928128	1894	616	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928128	3376	1056	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928128	3431	1071	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928129	1817	565	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928129	1894	616	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928129	3376	1056	QYSPSSHINLLTQQLDEEEERRKRRR
TTLL5	chr14	76259443	JDP2	chr14	75928129	3431	1071	QYSPSSHINLLTQQLDEEEERRKRRR

Top

Potential FusionNeoAntigen Information of TTLL5-JDP2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TTLL5-JDP2_76259443_75928128.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B08:01	HINLLTQQL	0.3806	0.8008	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B13:01	HINLLTQQL	0.1747	0.9345	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:01	SHINLLTQQL	0.9992	0.9639	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:24	SHINLLTQQL	0.9992	0.5768	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:06	SHINLLTQQL	0.9986	0.7977	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B38:02	SHINLLTQQL	0.9986	0.9817	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B38:01	SHINLLTQQL	0.9985	0.9767	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:10	SHINLLTQQL	0.995	0.6484	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:37	SHINLLTQQL	0.96	0.7191	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:18	SHINLLTQQL	0.9434	0.7513	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-C03:19	HINLLTQQL	0.9983	0.979	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-A02:05	HINLLTQQL	0.9052	0.5958	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-C02:06	HINLLTQQL	0.7495	0.9414	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:09	SHINLLTQQL	0.9992	0.7661	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:12	SHINLLTQQL	0.9991	0.9666	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:05	SHINLLTQQL	0.9987	0.9574	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-C03:05	HINLLTQQL	0.9933	0.9332	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:73	HINLLTQQL	0.7195	0.885	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B08:12	HINLLTQQL	0.683	0.9197	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-C17:01	HINLLTQQL	0.6435	0.9191	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:30	HINLLTQQL	0.5931	0.8103	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B07:13	HINLLTQQL	0.5188	0.8132	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B08:18	HINLLTQQL	0.3806	0.8008	6	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:31	SHINLLTQQL	0.9993	0.9639	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B38:05	SHINLLTQQL	0.9985	0.9767	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B15:09	SHINLLTQQL	0.9892	0.5827	5	15
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	HLA-B39:11	SHINLLTQQL	0.9231	0.8566	5	15

Top

Potential FusionNeoAntigen Information of TTLL5-JDP2 in HLA II

TTLL5-JDP2_76259443_75928128.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB1-0810	SSHINLLTQQLDEEE	4	19
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB1-0812	SSHINLLTQQLDEEE	4	19
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB1-0832	SSHINLLTQQLDEEE	4	19
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0101	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0101	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0101	INLLTQQLDEEEERR	7	22
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0103	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0103	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0103	INLLTQQLDEEEERR	7	22
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0104	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0104	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0106	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0106	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0106	INLLTQQLDEEEERR	7	22
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0107	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0107	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0107	INLLTQQLDEEEERR	7	22
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0108	HINLLTQQLDEEEER	6	21
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0108	SHINLLTQQLDEEEE	5	20
TTLL5-JDP2	chr14	76259443	chr14	75928128	3376	DRB4-0108	INLLTQQLDEEEERR	7	22

Top

Fusion breakpoint peptide structures of TTLL5-JDP2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3370	HINLLTQQLDEEEE	TTLL5	JDP2	chr14	76259443	chr14	75928128	3376

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TTLL5-JDP2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3370	HINLLTQQLDEEEE	-7.9962	-8.1096
HLA-B14:02	3BVN	3370	HINLLTQQLDEEEE	-5.70842	-6.74372
HLA-B52:01	3W39	3370	HINLLTQQLDEEEE	-6.83737	-6.95077
HLA-B52:01	3W39	3370	HINLLTQQLDEEEE	-4.4836	-5.5189
HLA-A11:01	4UQ2	3370	HINLLTQQLDEEEE	-10.0067	-10.1201
HLA-A11:01	4UQ2	3370	HINLLTQQLDEEEE	-9.03915	-10.0745
HLA-A24:02	5HGA	3370	HINLLTQQLDEEEE	-6.56204	-6.67544
HLA-A24:02	5HGA	3370	HINLLTQQLDEEEE	-5.42271	-6.45801
HLA-B44:05	3DX8	3370	HINLLTQQLDEEEE	-7.85648	-8.89178
HLA-B44:05	3DX8	3370	HINLLTQQLDEEEE	-5.3978	-5.5112
HLA-A02:01	6TDR	3370	HINLLTQQLDEEEE	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TTLL5-JDP2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TTLL5-JDP2	chr14	76259443	chr14	75928128	5	15	SHINLLTQQL	CACATCAACCTCCTCACCCAACAGCTAGAT
TTLL5-JDP2	chr14	76259443	chr14	75928128	6	15	HINLLTQQL	ATCAACCTCCTCACCCAACAGCTAGAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TTLL5-JDP2	chr14	76259443	chr14	75928128	4	19	SSHINLLTQQLDEEE	AGCCACATCAACCTCCTCACCCAACAGCTAGATGAGGAAGAGGAG
TTLL5-JDP2	chr14	76259443	chr14	75928128	5	20	SHINLLTQQLDEEEE	CACATCAACCTCCTCACCCAACAGCTAGATGAGGAAGAGGAGCGA
TTLL5-JDP2	chr14	76259443	chr14	75928128	6	21	HINLLTQQLDEEEER	ATCAACCTCCTCACCCAACAGCTAGATGAGGAAGAGGAGCGAAGG
TTLL5-JDP2	chr14	76259443	chr14	75928128	7	22	INLLTQQLDEEEERR	AACCTCCTCACCCAACAGCTAGATGAGGAAGAGGAGCGAAGGAAA

Top

Information of the samples that have these potential fusion neoantigens of TTLL5-JDP2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	TTLL5-JDP2	chr14	76259443	ENST00000298832	chr14	75928128	ENST00000419727	TCGA-L5-A4OQ

Top

Potential target of CAR-T therapy development for TTLL5-JDP2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TTLL5-JDP2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TTLL5-JDP2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)