Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TYR-MMP20

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TYR-MMP20
	FusionPDB ID: 95681
	FusionGDB2.0 ID: 95681
		Hgene	Tgene
	Gene symbol	TYR	MMP20
	Gene ID	7299	64386
	Gene name	tyrosinase	matrix metallopeptidase 25
	Synonyms	ATN\|CMM8\|OCA1\|OCA1A\|OCAIA\|SHEP3	MMP-25\|MMP20\|MMP20A\|MMPL1\|MT-MMP 6\|MT-MMP6\|MT6-MMP\|MT6MMP\|MTMMP6
	Cytomap	11q14.3	16p13.3
	Type of gene	protein-coding	protein-coding
	Description	tyrosinaseLB24-ABSK29-ABmonophenol monooxygenaseoculocutaneous albinism IAtumor rejection antigen AB	matrix metalloproteinase-25leukolysinmatrix metallopeptidase-like 1matrix metalloproteinase 20matrix metalloproteinase-like 1membrane-type 6 matrix metalloproteinasemembrane-type matrix metalloproteinase 6
	Modification date	20200322	20200313
	UniProtAcc	TDP2 Main function of 5'-partner protein: 362	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000526139, ENST00000263321,	ENST00000260228, ENST00000544938,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 1 X 2=10	2 X 5 X 5=50
	# samples	5	7
	** MAII score	log2(5/10*10)=2.32192809488736 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(7/50*10)=0.485426827170242 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: TYR [Title/Abstract] AND MMP20 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TYR [Title/Abstract] AND MMP20 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TYR(88924586)-MMP20(102480761), # samples:2
Anticipated loss of major functional domain due to fusion event.	TYR-MMP20 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TYR-MMP20 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TYR-MMP20 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TYR-MMP20 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TYR-MMP20 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. TYR-MMP20 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TYR	GO:0042438	melanin biosynthetic process	8126111

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:88924586/chr11:102480761)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TYR (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MMP20 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000263321

TYR

chr11

88924586

ENST00000260228

MMP20

chr11

102480761

2958

1538

502

2466

654

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000263321	ENST00000260228	TYR	chr11	88924586	+	MMP20	chr11	102480761	-	0.000870394	0.9991296

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TYR-MMP20

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TYR	chr11	88924586	MMP20	chr11	102480761	1538	345	DKAANFSFRNTLEDHGDSYPFDGPRG

Top

Potential FusionNeoAntigen Information of TYR-MMP20 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TYR-MMP20_88924586_102480761.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B18:01	LEDHGDSY	0.9866	0.7129	11	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B35:08	TLEDHGDSY	0.7619	0.7449	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:02	TLEDHGDSY	0.7055	0.7941	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:21	TLEDHGDSY	0.7097	0.764	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:05	TLEDHGDSY	0.6618	0.7263	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:31	TLEDHGDSY	0.5823	0.7324	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B18:05	LEDHGDSY	0.9866	0.7129	11	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B18:11	LEDHGDSY	0.9701	0.6791	11	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:12	TLEDHGDSY	0.7795	0.7258	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:11	TLEDHGDSY	0.72	0.7226	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:08	TLEDHGDSY	0.6984	0.7221	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B15:20	TLEDHGDSY	0.6745	0.7877	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B35:28	TLEDHGDSY	0.5609	0.7857	10	19
TYR-MMP20	chr11	88924586	chr11	102480761	1538	HLA-B35:20	TLEDHGDSY	0.5394	0.7909	10	19

Top

Potential FusionNeoAntigen Information of TYR-MMP20 in HLA II

TYR-MMP20_88924586_102480761.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0801	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0801	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0801	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0801	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0803	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0803	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0803	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0803	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0805	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0808	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0808	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0811	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0811	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0814	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0814	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0814	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0814	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0816	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0816	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0816	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0816	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0818	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0823	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0823	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0823	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0823	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0826	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0826	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0826	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0826	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0827	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0827	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0827	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0827	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0833	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0833	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0833	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0833	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0835	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0835	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0835	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0835	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0836	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0836	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0836	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0836	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0837	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0837	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0838	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0838	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0838	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0838	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0839	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0839	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0839	ANFSFRNTLEDHGDS	3	18
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-0839	DKAANFSFRNTLEDH	0	15
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1313	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1313	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1355	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1355	KAANFSFRNTLEDHG	1	16
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1463	AANFSFRNTLEDHGD	2	17
TYR-MMP20	chr11	88924586	chr11	102480761	1538	DRB1-1485	AANFSFRNTLEDHGD	2	17

Top

Fusion breakpoint peptide structures of TYR-MMP20

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8563	SFRNTLEDHGDSYP	TYR	MMP20	chr11	88924586	chr11	102480761	1538

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TYR-MMP20

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8563	SFRNTLEDHGDSYP	-6.77781	-6.89121
HLA-B14:02	3BVN	8563	SFRNTLEDHGDSYP	-3.08719	-4.12249
HLA-B52:01	3W39	8563	SFRNTLEDHGDSYP	-6.66315	-6.77655
HLA-B52:01	3W39	8563	SFRNTLEDHGDSYP	-2.65785	-3.69315
HLA-A24:02	5HGA	8563	SFRNTLEDHGDSYP	-7.20627	-7.31967
HLA-A24:02	5HGA	8563	SFRNTLEDHGDSYP	-6.50211	-7.53741
HLA-B44:05	3DX8	8563	SFRNTLEDHGDSYP	-7.75024	-7.86364
HLA-B44:05	3DX8	8563	SFRNTLEDHGDSYP	-6.53073	-7.56603
HLA-A02:01	6TDR	8563	SFRNTLEDHGDSYP	-4.4528	-5.4881

Top

Vaccine Design for the FusionNeoAntigens of TYR-MMP20

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TYR-MMP20	chr11	88924586	chr11	102480761	10	19	TLEDHGDSY	CACTGGAAGATCACGGGGATTCCTATC
TYR-MMP20	chr11	88924586	chr11	102480761	11	19	LEDHGDSY	TGGAAGATCACGGGGATTCCTATC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TYR-MMP20	chr11	88924586	chr11	102480761	0	15	DKAANFSFRNTLEDH	ATAAAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGATCACG
TYR-MMP20	chr11	88924586	chr11	102480761	1	16	KAANFSFRNTLEDHG	AAGCTGCCAATTTCAGCTTTAGAAATACACTGGAAGATCACGGGG
TYR-MMP20	chr11	88924586	chr11	102480761	2	17	AANFSFRNTLEDHGD	CTGCCAATTTCAGCTTTAGAAATACACTGGAAGATCACGGGGATT
TYR-MMP20	chr11	88924586	chr11	102480761	3	18	ANFSFRNTLEDHGDS	CCAATTTCAGCTTTAGAAATACACTGGAAGATCACGGGGATTCCT

Top

Information of the samples that have these potential fusion neoantigens of TYR-MMP20

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SKCM	TYR-MMP20	chr11	88924586	ENST00000263321	chr11	102480761	ENST00000260228	TCGA-EB-A57M-01A

Top

Potential target of CAR-T therapy development for TYR-MMP20

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TYR-MMP20

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TYR-MMP20

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)