Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:UCK2-TDRKH

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: UCK2-TDRKH
	FusionPDB ID: 96573
	FusionGDB2.0 ID: 96573
		Hgene	Tgene
	Gene symbol	UCK2	TDRKH
	Gene ID	7371	11022
	Gene name	uridine-cytidine kinase 2	tudor and KH domain containing
	Synonyms	TSA903\|UK\|UMPK	TDRD2
	Cytomap	1q24.1	1q21.3
	Type of gene	protein-coding	protein-coding
	Description	uridine-cytidine kinase 2cytidine monophosphokinase 2testis-specific protein TSA903uridine kinaseuridine monophosphate kinaseuridine monophosphokinase 2	tudor and KH domain-containing proteinputative RNA binding proteintudor domain containing 2tudor domain-containing protein 2
	Modification date	20200313	20200315
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000367879, ENST00000372212, ENST00000462329, ENST00000469256, ENST00000470820,	ENST00000484421, ENST00000368822, ENST00000368823, ENST00000368824, ENST00000368825, ENST00000368827, ENST00000440583, ENST00000458431,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	17 X 9 X 9=1377	4 X 3 X 4=48
	# samples	20	5
	** MAII score	log2(20/1377*10)=-2.78345665436024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/48*10)=0.0588936890535686 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: UCK2 [Title/Abstract] AND TDRKH [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: UCK2 [Title/Abstract] AND TDRKH [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	UCK2(165797169)-TDRKH(151747642), # samples:1
Anticipated loss of major functional domain due to fusion event.	UCK2-TDRKH seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UCK2-TDRKH seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:165797169/chr1:151747642)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across UCK2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TDRKH (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367879	UCK2	chr1	165797169	+	ENST00000368827	TDRKH	chr1	151747642	-	1116	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000368825	TDRKH	chr1	151747642	-	1627	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000368824	TDRKH	chr1	151747642	-	1622	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000368823	TDRKH	chr1	151747642	-	1614	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000368822	TDRKH	chr1	151747642	-	1427	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000458431	TDRKH	chr1	151747642	-	1608	402	120	653	177
ENST00000367879	UCK2	chr1	165797169	+	ENST00000440583	TDRKH	chr1	151747642	-	822	402	120	653	177
ENST00000372212	UCK2	chr1	165797169	+	ENST00000368827	TDRKH	chr1	151747642	-	825	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000368825	TDRKH	chr1	151747642	-	1336	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000368824	TDRKH	chr1	151747642	-	1331	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000368823	TDRKH	chr1	151747642	-	1323	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000368822	TDRKH	chr1	151747642	-	1136	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000458431	TDRKH	chr1	151747642	-	1317	111	12	362	116
ENST00000372212	UCK2	chr1	165797169	+	ENST00000440583	TDRKH	chr1	151747642	-	531	111	12	362	116

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367879	ENST00000368827	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.036518592	0.9634814
ENST00000367879	ENST00000368825	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.015144696	0.98485523
ENST00000367879	ENST00000368824	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.015766969	0.984233
ENST00000367879	ENST00000368823	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.01562845	0.9843716
ENST00000367879	ENST00000368822	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.020802068	0.979198
ENST00000367879	ENST00000458431	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.015445842	0.9845541
ENST00000367879	ENST00000440583	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.023281004	0.976719
ENST00000372212	ENST00000368827	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.020706711	0.97929335
ENST00000372212	ENST00000368825	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.013108513	0.98689145
ENST00000372212	ENST00000368824	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.012820593	0.98717934
ENST00000372212	ENST00000368823	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.012647026	0.98735297
ENST00000372212	ENST00000368822	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.01592744	0.9840725
ENST00000372212	ENST00000458431	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.012478819	0.9875212
ENST00000372212	ENST00000440583	UCK2	chr1	165797169	+	TDRKH	chr1	151747642	-	0.010453506	0.9895465

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for UCK2-TDRKH

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
UCK2	chr1	165797169	TDRKH	chr1	151747642	111	33	FLIGVSGGTASGKKLDIGLELVHKGY
UCK2	chr1	165797169	TDRKH	chr1	151747642	402	19	PAPSPGSERLAGERQRPQPRQRPAAA

Top

Potential FusionNeoAntigen Information of UCK2-TDRKH in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

UCK2-TDRKH_165797169_151747642.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B27:04	KKLDIGLEL	0.9941	0.7674	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:01	KKLDIGLEL	0.9784	0.911	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:13	KKLDIGLEL	0.9019	0.8966	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B38:01	KKLDIGLEL	0.8823	0.9659	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B38:02	KKLDIGLEL	0.8706	0.9696	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B15:10	KKLDIGLEL	0.6011	0.5903	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B15:03	KKLDIGLEL	0.4963	0.7817	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B47:01	KKLDIGLEL	0.0905	0.66	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B48:01	GKKLDIGLEL	0.8268	0.5839	11	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-A11:03	GVSGGTASGKK	0.9992	0.6336	3	14
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:95	KKLDIGLEL	0.9979	0.7859	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:05	KKLDIGLEL	0.9959	0.9659	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:27	KKLDIGLEL	0.9941	0.9647	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:13	KKLDIGLEL	0.9897	0.9474	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:29	KKLDIGLEL	0.9893	0.9485	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:10	KKLDIGLEL	0.9778	0.9677	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:80	KKLDIGLEL	0.9774	0.9512	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:67	KKLDIGLEL	0.9774	0.9512	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:09	KKLDIGLEL	0.9658	0.6404	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:19	KKLDIGLEL	0.9584	0.8221	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:46	KKLDIGLEL	0.9353	0.9142	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:05	KKLDIGLEL	0.8457	0.8925	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:08	KKLDIGLEL	0.6606	0.8983	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C12:16	KKLDIGLEL	0.1267	0.9656	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:01	KKLDIGLEL	0.9981	0.7994	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B27:08	KKLDIGLEL	0.9951	0.8028	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B27:09	KKLDIGLEL	0.9948	0.8664	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B27:06	KKLDIGLEL	0.994	0.7628	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:02	KKLDIGLEL	0.9906	0.9038	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:31	KKLDIGLEL	0.9838	0.9122	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:17	KKLDIGLEL	0.9785	0.9637	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:02	KKLDIGLEL	0.9774	0.9512	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C06:06	KKLDIGLEL	0.9117	0.9881	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B38:05	KKLDIGLEL	0.8823	0.9659	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:04	KKLDIGLEL	0.8819	0.9448	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C07:22	KKLDIGLEL	0.828	0.7655	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C06:08	KKLDIGLEL	0.8005	0.985	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B39:11	KKLDIGLEL	0.6578	0.8454	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B15:09	KKLDIGLEL	0.4982	0.6495	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B48:02	KKLDIGLEL	0.4266	0.9215	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C06:02	KKLDIGLEL	0.3713	0.9882	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-C06:17	KKLDIGLEL	0.3713	0.9882	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B15:68	KKLDIGLEL	0.1645	0.68	12	21
UCK2-TDRKH	chr1	165797169	chr1	151747642	111	HLA-B15:54	KKLDIGLEL	0.1195	0.8712	12	21

Top

Potential FusionNeoAntigen Information of UCK2-TDRKH in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of UCK2-TDRKH

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2841	GGTASGKKLDIGLE	UCK2	TDRKH	chr1	165797169	chr1	151747642	111

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of UCK2-TDRKH

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2841	GGTASGKKLDIGLE	-7.15543	-7.26883
HLA-B14:02	3BVN	2841	GGTASGKKLDIGLE	-4.77435	-5.80965
HLA-B52:01	3W39	2841	GGTASGKKLDIGLE	-6.80875	-6.92215
HLA-B52:01	3W39	2841	GGTASGKKLDIGLE	-4.20386	-5.23916
HLA-A11:01	4UQ2	2841	GGTASGKKLDIGLE	-7.5194	-8.5547
HLA-A11:01	4UQ2	2841	GGTASGKKLDIGLE	-6.9601	-7.0735
HLA-A24:02	5HGA	2841	GGTASGKKLDIGLE	-7.52403	-7.63743
HLA-A24:02	5HGA	2841	GGTASGKKLDIGLE	-5.82433	-6.85963
HLA-B27:05	6PYJ	2841	GGTASGKKLDIGLE	-3.28285	-4.31815
HLA-B44:05	3DX8	2841	GGTASGKKLDIGLE	-5.91172	-6.94702
HLA-B44:05	3DX8	2841	GGTASGKKLDIGLE	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of UCK2-TDRKH

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
UCK2-TDRKH	chr1	165797169	chr1	151747642	11	21	GKKLDIGLEL	GGCAAGAAACTTGATATTGGGCTAGAATTA
UCK2-TDRKH	chr1	165797169	chr1	151747642	12	21	KKLDIGLEL	AAGAAACTTGATATTGGGCTAGAATTA
UCK2-TDRKH	chr1	165797169	chr1	151747642	3	14	GVSGGTASGKK	GGCGTCAGCGGGGGAACAGCTAGCGGCAAGAAA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of UCK2-TDRKH

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	UCK2-TDRKH	chr1	165797169	ENST00000372212	chr1	151747642	ENST00000368822	TCGA-GU-A764-01A

Top

Potential target of CAR-T therapy development for UCK2-TDRKH

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to UCK2-TDRKH

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to UCK2-TDRKH

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)