![]() |
|||||||
|
Fusion Protein:UQCC1-ASXL1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: UQCC1-ASXL1 | FusionPDB ID: 96946 | FusionGDB2.0 ID: 96946 | Hgene | Tgene | Gene symbol | UQCC1 | ASXL1 | Gene ID | 55245 | 171023 |
Gene name | ubiquinol-cytochrome c reductase complex assembly factor 1 | ASXL transcriptional regulator 1 | |
Synonyms | BFZB|C20orf44|CBP3|UQCC | BOPS|MDS | |
Cytomap | 20q11.22 | 20q11.21 | |
Type of gene | protein-coding | protein-coding | |
Description | ubiquinol-cytochrome-c reductase complex assembly factor 1bFGF-repressed Zic-binding proteinbasic FGF-repressed Zic-binding proteincytochrome B protein synthesis 3 homologubiquinol-cytochrome c reductase complex chaperone CBP3 homolog | polycomb group protein ASXL1additional sex combs like 1, transcriptional regulatoradditional sex combs like transcriptional regulator 1putative Polycomb group protein ASXL1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q8IXJ9 Main function of 5'-partner protein: FUNCTION: Probable Polycomb group (PcG) protein involved in transcriptional regulation mediated by ligand-bound nuclear hormone receptors, such as retinoic acid receptors (RARs) and peroxisome proliferator-activated receptor gamma (PPARG) (PubMed:16606617). Acts as coactivator of RARA and RXRA through association with NCOA1 (PubMed:16606617). Acts as corepressor for PPARG and suppresses its adipocyte differentiation-inducing activity (By similarity). Non-catalytic component of the PR-DUB complex, a complex that specifically mediates deubiquitination of histone H2A monoubiquitinated at 'Lys-119' (H2AK119ub1) (PubMed:20436459). Acts as a sensor of N(6)-methyladenosine methylation on DNA (m6A): recognizes and binds m6A DNA, leading to its ubiquitination and degradation by TRIP12, thereby inactivating the PR-DUB complex and regulating Polycomb silencing (PubMed:30982744). {ECO:0000250|UniProtKB:P59598, ECO:0000269|PubMed:16606617, ECO:0000269|PubMed:20436459, ECO:0000269|PubMed:30982744}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000349714, ENST00000374377, ENST00000374380, ENST00000374384, ENST00000374385, ENST00000397556, ENST00000540457, ENST00000542501, ENST00000491125, ENST00000359226, ENST00000397554, ENST00000407996, | ENST00000470145, ENST00000542461, ENST00000306058, ENST00000375689, ENST00000375687, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 20 X 11 X 12=2640 | 10 X 7 X 6=420 |
# samples | 20 | 10 | |
** MAII score | log2(20/2640*10)=-3.72246602447109 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/420*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: UQCC1 [Title/Abstract] AND ASXL1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: UQCC1 [Title/Abstract] AND ASXL1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | UQCC1(33934967)-ASXL1(31015931), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | UQCC1-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. UQCC1-ASXL1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | UQCC1 | GO:0034551 | mitochondrial respiratory chain complex III assembly | 24385928 |
Hgene | UQCC1 | GO:0070131 | positive regulation of mitochondrial translation | 24385928 |
Tgene | ASXL1 | GO:0035522 | monoubiquitinated histone H2A deubiquitination | 20436459 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:33934967/chr20:31015931) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000349714 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 6847 | 492 | 0 | 4865 | 1621 |
ENST00000374384 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 6938 | 583 | 1 | 4956 | 1651 |
ENST00000374380 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 6792 | 437 | 59 | 4810 | 1583 |
ENST00000374385 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 7106 | 751 | 169 | 5124 | 1651 |
ENST00000397556 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 6783 | 428 | 20 | 4801 | 1593 |
ENST00000542501 | UQCC1 | chr20 | 33934967 | - | ENST00000375687 | ASXL1 | chr20 | 31015931 | + | 6807 | 452 | 344 | 4825 | 1493 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000349714 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001154311 | 0.9988457 |
ENST00000374384 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001145785 | 0.99885416 |
ENST00000374380 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001286663 | 0.9987134 |
ENST00000374385 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001352527 | 0.9986475 |
ENST00000397556 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001275476 | 0.9987245 |
ENST00000542501 | ENST00000375687 | UQCC1 | chr20 | 33934967 | - | ASXL1 | chr20 | 31015931 | + | 0.001627768 | 0.99837226 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for UQCC1-ASXL1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 428 | 136 | MWEDVQQRGRVMGKDALQWSRHPATV |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 437 | 126 | MWEDVQQRGRVMGKDALQWSRHPATV |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 452 | 36 | MWEDVQQRGRVMGKDALQWSRHPATV |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 492 | 164 | MWEDVQQRGRVMGKDALQWSRHPATV |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 583 | 194 | MWEDVQQRGRVMGKDALQWSRHPATV |
UQCC1 | chr20 | 33934967 | ASXL1 | chr20 | 31015931 | 751 | 194 | MWEDVQQRGRVMGKDALQWSRHPATV |
Top |
Potential FusionNeoAntigen Information of UQCC1-ASXL1 in HLA I |
![]() |
UQCC1-ASXL1_33934967_31015931.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B27:07 | GRVMGKDAL | 0.9976 | 0.5527 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:01 | VMGKDALQW | 0.994 | 0.9906 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A30:08 | QQRGRVMGK | 0.992 | 0.6864 | 5 | 14 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:01 | VMGKDALQW | 0.9896 | 0.9855 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B39:01 | GRVMGKDAL | 0.9794 | 0.8632 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:02 | VMGKDALQW | 0.9788 | 0.9857 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A31:08 | VMGKDALQW | 0.971 | 0.7649 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A32:13 | VMGKDALQW | 0.9624 | 0.9941 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:03 | VMGKDALQW | 0.9475 | 0.9968 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B07:10 | GRVMGKDAL | 0.06 | 0.5953 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:01 | RVMGKDALQW | 0.9999 | 0.9936 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:02 | RVMGKDALQW | 0.9998 | 0.9874 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:03 | RVMGKDALQW | 0.9994 | 0.9977 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A31:08 | RVMGKDALQW | 0.9994 | 0.8129 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:01 | RVMGKDALQW | 0.9992 | 0.9893 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B15:16 | RVMGKDALQW | 0.9987 | 0.9845 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B15:17 | RVMGKDALQW | 0.9985 | 0.9799 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A32:13 | RVMGKDALQW | 0.9983 | 0.9731 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B39:09 | GRVMGKDAL | 0.9875 | 0.7458 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B39:12 | GRVMGKDAL | 0.9791 | 0.867 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B39:05 | GRVMGKDAL | 0.8251 | 0.8371 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B44:08 | RVMGKDALQW | 0.8202 | 0.8897 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B27:08 | GRVMGKDAL | 0.998 | 0.5867 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B27:06 | GRVMGKDAL | 0.9976 | 0.7684 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B27:09 | GRVMGKDAL | 0.9968 | 0.6159 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:10 | VMGKDALQW | 0.994 | 0.9906 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A30:01 | QQRGRVMGK | 0.9901 | 0.8134 | 5 | 14 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:04 | VMGKDALQW | 0.99 | 0.8896 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A32:01 | VMGKDALQW | 0.9786 | 0.9879 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B39:31 | GRVMGKDAL | 0.9783 | 0.8643 | 8 | 17 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:06 | VMGKDALQW | 0.9678 | 0.9848 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:02 | VMGKDALQW | 0.9407 | 0.9807 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B15:13 | VMGKDALQW | 0.8076 | 0.9796 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B15:24 | VMGKDALQW | 0.7735 | 0.9886 | 10 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:10 | RVMGKDALQW | 0.9999 | 0.9936 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:04 | RVMGKDALQW | 0.9996 | 0.8694 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B58:06 | RVMGKDALQW | 0.9996 | 0.9876 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-A32:01 | RVMGKDALQW | 0.9995 | 0.9871 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B57:02 | RVMGKDALQW | 0.997 | 0.992 | 9 | 19 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | HLA-B15:24 | RVMGKDALQW | 0.9935 | 0.9887 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of UQCC1-ASXL1 in HLA II |
![]() |
UQCC1-ASXL1_33934967_31015931.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1103 | WEDVQQRGRVMGKDA | 1 | 16 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1155 | WEDVQQRGRVMGKDA | 1 | 16 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1163 | WEDVQQRGRVMGKDA | 1 | 16 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1176 | WEDVQQRGRVMGKDA | 1 | 16 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1185 | WEDVQQRGRVMGKDA | 1 | 16 |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 | DRB1-1324 | WEDVQQRGRVMGKDA | 1 | 16 |
Top |
Fusion breakpoint peptide structures of UQCC1-ASXL1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7536 | QRGRVMGKDALQWS | UQCC1 | ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 492 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of UQCC1-ASXL1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7536 | QRGRVMGKDALQWS | -5.49577 | -5.60917 |
HLA-B14:02 | 3BVN | 7536 | QRGRVMGKDALQWS | -4.37152 | -5.40682 |
HLA-B52:01 | 3W39 | 7536 | QRGRVMGKDALQWS | -6.90336 | -7.01676 |
HLA-B52:01 | 3W39 | 7536 | QRGRVMGKDALQWS | -4.80833 | -5.84363 |
HLA-A11:01 | 4UQ2 | 7536 | QRGRVMGKDALQWS | -9.82261 | -9.93601 |
HLA-A24:02 | 5HGA | 7536 | QRGRVMGKDALQWS | -9.78612 | -9.89952 |
HLA-A24:02 | 5HGA | 7536 | QRGRVMGKDALQWS | -4.98992 | -6.02522 |
HLA-B27:05 | 6PYJ | 7536 | QRGRVMGKDALQWS | -5.31553 | -6.35083 |
HLA-B44:05 | 3DX8 | 7536 | QRGRVMGKDALQWS | -5.70582 | -5.81922 |
HLA-B44:05 | 3DX8 | 7536 | QRGRVMGKDALQWS | -4.32241 | -5.35771 |
Top |
Vaccine Design for the FusionNeoAntigens of UQCC1-ASXL1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 10 | 19 | VMGKDALQW | GTCATGGGGAAGGATGCCCTGCAGTGG |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 5 | 14 | QQRGRVMGK | CAGCAGCGCGGCAGAGTCATGGGGAAG |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 8 | 17 | GRVMGKDAL | GGCAGAGTCATGGGGAAGGATGCCCTG |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 9 | 19 | RVMGKDALQW | AGAGTCATGGGGAAGGATGCCCTGCAGTGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
UQCC1-ASXL1 | chr20 | 33934967 | chr20 | 31015931 | 1 | 16 | WEDVQQRGRVMGKDA | TGGGAGGATGTTCAGCAGCGCGGCAGAGTCATGGGGAAGGATGCC |
Top |
Information of the samples that have these potential fusion neoantigens of UQCC1-ASXL1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SARC | UQCC1-ASXL1 | chr20 | 33934967 | ENST00000349714 | chr20 | 31015931 | ENST00000375687 | TCGA-DX-A8BU-01A |
Top |
Potential target of CAR-T therapy development for UQCC1-ASXL1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to UQCC1-ASXL1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to UQCC1-ASXL1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |